aimP

168

peptide, part of the arbitrium peptide-based communication system, processed AimP peptide inactivates AimR

Locus: BSU_20850

Molecular weight: 4.08 kDa

Isoelectric point: 6.26

Protein length: 41 aa

Gene length: 126 bp

Function: control of AimR activity

Product: arbitrium peptide

Essential: no

E.C.: null

Synonyms: aimP, AimP, yopL

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms

Gene

Coordinates: 2,208,855  2,208,980

Phenotypes of a mutant

• increased prophage production PubMed
• sharper plaque morphology (similar to yopN mutant) PubMed

The protein

Catalyzed reaction/ biological activity

• Proteolytically cleaved in extracellular space to yield hexapeptide (GMPRGA) regulator. Hexapeptide re-enters cells and binds to AimR to promote SPbeta lysogeny.  (PubMed)

Structure

• Hexapeptide bound to AimR: 5Y24 (PDB) (PubMed), 5ZW6 (PDB) (PubMed), 6IM4 (PDB) (PubMed), 6HP5 (PDB) (PubMed), 6JG9 (PDB) (PubMed)
• O31926 (AlphaFold)

Expression and Regulation

Operons

• Genes: aimR-aimP

  Description

  • PubMed

  Expression

  • repressed by MrpR

  Regulatory mechanism

  • MrpR: repression, in mrpR regulon

• Genes: aimP

  Description: PubMed

  Regulation

  • expressed during the lytic cycle PubMed

  Regulatory mechanism

  • CcpA: repression, CcpA: transcription repression PubMed, in ccpA regulon

Additional information

• produce as 43 aa pro-peptide, secreted to the medium, and processed to the mature 6 aa AimX peptide that can be taken up by the cells again PubMed

Biological materials

Mutant

• BKE20850 (aimP::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTGTCTCACCTCCTTTAA,  downstream forward: _UP4_TAAAATCCATTGACACATAA
• BKK20850 (aimP::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTGTCTCACCTCCTTTAA,  downstream forward: _UP4_TAAAATCCATTGACACATAA

References

Kohm K, Clanner AV, Hertel R, Commichau FMClosely related and yet special - how SPβ family phages control lysis-lysogeny decisions.Trends in microbiology. 2024 Dec 6; . PMID: 39645480
Kohm K, Jalomo-Khayrova E, Krüger A, Basu S, Steinchen W, Bange G, Frunzke J, Hertel R, Commichau FM, Czech LStructural and functional characterization of MrpR, the master repressor of the Bacillus subtilis prophage SPβ.Nucleic acids research. 2023 Aug 21; . PMID: 37602373
Bruce JB, Lion S, Buckling A, Westra ER, Gandon SRegulation of prophage induction and lysogenization by phage communication systems.Current biology : CB. 2021 Sep 22; . PMID: 34562385
Brady A, Quiles-Puchalt N, Gallego Del Sol F, Zamora-Caballero S, Felipe-Ruíz A, Val-Calvo J, Meijer WJJ, Marina A, Penadés JRThe arbitrium system controls prophage induction.Current biology : CB. 2021 Sep 22; . PMID: 34562384
Guan Z, Pei K, Wang J, Cui Y, Zhu X, Su X, Zhou Y, Zhang D, Tang C, Yin P, Liu Z, Zou T Structural insights into DNA recognition by AimR of the arbitrium communication system in the SPbeta phage. Cell discovery. 2019; 5:29. doi:10.1038/s41421-019-0101-2. PMID:31149347
Gallego Del Sol F, Penadés JR, Marina A Deciphering the Molecular Mechanism Underpinning Phage Arbitrium Communication Systems. Molecular cell. 2019 Feb 06; . pii:S1097-2765(19)30045-0. doi:10.1016/j.molcel.2019.01.025. PMID:30745087
Zhen X, Zhou H, Ding W, Zhou B, Xu X, Perčulija V, Chen CJ, Chang MX, Choudhary MI, Ouyang S Structural basis of AimP signaling molecule recognition by AimR in Spbeta group of bacteriophages. Protein & cell. 2019 Feb; 10(2):131-136. doi:10.1007/s13238-018-0588-6. PMID:30421358
Dou C, Xiong J, Gu Y, Yin K, Wang J, Hu Y, Zhou D, Fu X, Qi S, Zhu X, Yao S, Xu H, Nie C, Liang Z, Yang S, Wei Y, Cheng W Structural and functional insights into the regulation of the lysis-lysogeny decision in viral communities. Nature microbiology. 2018 Nov; 3(11):1285-1294. doi:10.1038/s41564-018-0259-7. PMID:30323253
Wang Q, Guan Z, Pei K, Wang J, Liu Z, Yin P, Peng D, Zou T Structural basis of the arbitrium peptide-AimR communication system in the phage lysis-lysogeny decision. Nature microbiology. 2018 Nov; 3(11):1266-1273. doi:10.1038/s41564-018-0239-y. PMID:30224798
Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B, Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P, Noirot P Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science (New York, N.Y.). 2012 Mar 02; 335(6072):1103-6. doi:10.1126/science.1206848. PMID:22383849
Irnov I, Sharma CM, Vogel J, Winkler WC Identification of regulatory RNAs in Bacillus subtilis. Nucleic acids research. 2010 Oct; 38(19):6637-51. doi:10.1093/nar/gkq454. PMID:20525796
Blencke HM, Homuth G, Ludwig H, Mäder U, Hecker M, Stülke J Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metabolic engineering. 2003 Apr; 5(2):133-49. . PMID:12850135
Blencke HM, Homuth G, Ludwig H, Mäder U, Hecker M, Stülke J Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metabolic engineering. 2003 Apr; 5(2):133-49. . PMID:12850135