yngB

168

UTP-glucose-1-phosphate uridylyltransferase, important for wall teichoic acid modification and glycolipid formation during anaerobic growth

Locus: BSU_18180

Molecular weight: 32.99 kDa

Isoelectric point: 5.2

Protein length: 297 aa

Gene length: 894 bp

Function: wall teichoic acid modification and glycolipid formation under anaerobic conditions

Product: UTP-glucose-1-phosphate uridylyltransferase

Essential: no

Synonyms: yngB

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Cell envelope and cell division, Cell wall/ other/ based on similarity

List of homologs in different organisms, belongs to COG1210 (Galperin et al., 2021)

Gene

Coordinates: 1,946,702  1,947,595

The protein

Catalyzed reaction/ biological activity

produces UDP-glucose from UTP and glucose-1-phosphate PubMed

Protein family

UDPGP type 2 family (with GtaB and YtdA, according to UniProt)

Structure

7B1R (PDB) PubMed
5I1F (PDB) (from Burkholderia vietnamiensis, 50% identity)
O31822 (AlphaFold)

Paralogous protein(s)

GtaB, YtdA

Expression and Regulation

Operons

Genes: yngA-yngB-uptA

Description: PubMed

Regulation

expression during spore germination is strongly reduced under conditions of osmotic stress PubMed
expressed under anaerobic conditions (YclJ) PubMed

Regulatory mechanism

YclJ: activation, PubMed, in yclJ regulon

Biological materials

Mutant

MGNA-B396 (yngB::erm), available at the NBRP B. subtilis, Japan
BKE18180 (yngB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TCTCACTTTTTTTCTCATTC,  downstream forward: _UP4_TAAAAAAATTGTAACCATCT
BKK18180 (yngB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TCTCACTTTTTTTCTCATTC,  downstream forward: _UP4_TAAAAAAATTGTAACCATCT

References

Loading