pksJ

168

polyketide synthase

Locus: BSU_17180

Molecular weight: 562.00 kDa

Isoelectric point: 5

Protein length: 5043 aa

Gene length: 15132 bp

Function: polyketide synthesis

Product: polyketide synthase

Essential: no

Synonyms: pksJ, pksK

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Additional metabolic pathways, Miscellaneous metabolic pathways, Biosynthesis of antibacterial compounds

Lifestyles, Coping with stress, Biosynthesis of antibacterial compounds

List of homologs in different organisms, belongs to COG4908 (Galperin et al., 2021)

This gene is a member of the following regulons

CodY regulon, AbrB regulon

Gene

Coordinates: 1,792,806  1,807,937

The protein

Protein family

ATP-dependent AMP-binding enzyme family (according to UniProt)

Domains

5 Carrier domains (aa 590-667, aa 1654-1729, aa 3114-3188, aa 3212-3286, aa 4459-4536) (according to UniProt)

Structure

4NA1 (PDB) PubMed

Expression and Regulation

Operons

Genes: pksC-pksD-pksE-acpK-pksF-pksG-pksH-pksI-pksJ-pksL-pksM-pksN-pksR

Description: PubMed

Regulation

expressed during the transition from growth to stationary phase (AbrB, CodY) PubMed
heterogeneous expression, percentage of expressing cells increases during colonization of plant roots PubMed

Regulatory mechanism

AbrB: repression, PubMed, in abrB regulon
CodY: activation, PubMed, in codY regulon

Additional information

this is a very large operon comprising about 75 kb

Genes: pksB-pksC-pksD-pksE-acpK-pksF-pksG-pksH-pksI-pksJ-pksL-pksM-pksN-pksR

Description: PubMed

Biological materials

Mutant

BKE17180 (pksJ::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCACGCTGCCTCCATTTC,  downstream forward: _UP4_ACTGCGGCAAACATATGGGA
BKK17180 (pksJ::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCACGCTGCCTCCATTTC,  downstream forward: _UP4_ACTGCGGCAAACATATGGGA

References

Loading