rnpM

168

modulator of RNase P

Locus: BSU_16610

Molecular weight: 10.27 kDa

Isoelectric point: 10.09

Protein length: 91 aa

Gene length: 276 bp

Function: control of tRNA maturation

Product: modulator of RNase P

Essential: no

Synonyms: ylxR, ymxB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2740 (Galperin et al., 2021)

Gene

Coordinates: 1,733,410 → 1,733,685

The protein

Catalyzed reaction/ biological activity

• binds to the RNA component (RnpB) of RNase P to limit its activity PubMed

Structure

• 1G2R (PDB) (from Streptococcus pneumoniae, 47% identity) PubMed
• P32728 (AlphaFold)

Kinetic information

• K_D (RnpM-RnpB interaction): 460 pM PubMed

Expression and Regulation

Operons

• Genes: ylxS-nusA-rnpM-rplGA-infB-ylxP-rbfA

  Description: PubMed

  Regulation

  • autoregulation NusA PubMed
  • induced by glucose PubMed
  • expression is reduced in motile cells as compared to non-motile cells PubMed

  Regulatory mechanism

  • stringent response: negative regulation, in stringent response
  • NusA: attenuation, NusA stimulates termination PubMed, in nusA regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigB: sigma factor, PubMed, in sigB regulon

Biological materials

Mutant

• GP3753 (rnpM::kan), available in Jörg Stülke's lab
• MGNA-B078 (ΔylxR::erm), available at the NBRP B. subtilis, Japan
• BKE16610 (ΔrnpM::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACCTAAAGTCACCTCTTAT,  downstream forward: _UP4_CTGGCGGAAAAGGTGAAAAA
• BKK16610 (ΔrnpM::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACCTAAAGTCACCTCTTAT,  downstream forward: _UP4_CTGGCGGAAAAGGTGAAAAA

Expression vectors

• pGP3617 expression of rnpM-Strep by pGP382 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP3618 (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in Jörg Stülke's lab
• pGP3647: expression of rnpM by pBQ200 in B. subtilis, available in Jörg Stülke's lab
• pGP3650: (N-terminal Strep-tag, purification from E. coli, in pGP172), available in Jörg Stülke's lab
• pGP3651: (N-terminal Strep-tag, purification from E. coli, in pGP574), available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

References

Reviews

Loading

Original Publications

Loading