codV

168

site-specific integrase/recombinase, partitioning of the terminus region after replication

Locus: BSU_16140

Molecular weight: 35.19 kDa

Isoelectric point: 9.31

Protein length: 304 aa

Gene length: 915 bp

Function: chromosome partitioning

Product: site-specific integrase/recombinase

Essential: no

Synonyms: codV

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG4974 (Galperin et al., 2021)

Gene

Coordinates: 1,687,187  1,688,101

The protein

Catalyzed reaction/ biological activity

• resolution of chromosome dimers by site specific recombination at the dif site (located close to the terminus region on the chromosome)

Protein family

• phage integrase family (according to UniProt)

Structure

• 1A0P (PDB) (from E. coli, 39% identity, complex with XerD) PubMed
• P39776 (AlphaFold)

Paralogous protein(s)

• XerD

Localization

• cytoplasm (according to Swiss-Prot)
• assembles on the chromosome at the dif site throughout the cell cycle PubMed

Expression and Regulation

Operons

• Genes: trmFO-codV-clpQ-clpY-codY

  Description: PubMed

  Regulation

  • repressed during growth in the presence of branched chain amino acids (CodY) PubMed

  Regulatory mechanism

  • CodY: repression, PubMed, in codY regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • the intracellular concentration of CodY is about 2.5 myM (according to PubMed)

Biological materials

Mutant

• 1A794 ( codV::kan), PubMed, available at BGSC
• BKE16140 (codV::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGCCTAATACCTCCCCAG,  downstream forward: _UP4_AAGAAAAATTAAAGGAGGCC
• BKK16140 (codV::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGCCTAATACCTCCCCAG,  downstream forward: _UP4_AAGAAAAATTAAAGGAGGCC

References

Reviews

Wang X, Montero Llopis P, Rudner DZ Organization and segregation of bacterial chromosomes. Nature reviews. Genetics. 2013 Mar; 14(3):191-203. doi:10.1038/nrg3375. PMID:23400100

Original Publications

Kaimer C, Schenk K, Graumann PL Two DNA translocases synergistically affect chromosome dimer resolution in Bacillus subtilis. Journal of bacteriology. 2011 Mar; 193(6):1334-40. doi:10.1128/JB.00918-10. PMID:21239579
Bloor AE, Cranenburgh RM An efficient method of selectable marker gene excision by Xer recombination for gene replacement in bacterial chromosomes. Applied and environmental microbiology. 2006 Apr; 72(4):2520-5. . PMID:16597952
Ratnayake-Lecamwasam M, Serror P, Wong KW, Sonenshein AL Bacillus subtilis CodY represses early-stationary-phase genes by sensing GTP levels. Genes & development. 2001 May 01; 15(9):1093-103. . PMID:11331605
Sciochetti SA, Piggot PJ, Blakely GW Identification and characterization of the dif Site from Bacillus subtilis. Journal of bacteriology. 2001 Feb; 183(3):1058-68. . PMID:11208805
Sciochetti SA, Piggot PJ, Sherratt DJ, Blakely G The ripX locus of Bacillus subtilis encodes a site-specific recombinase involved in proper chromosome partitioning. Journal of bacteriology. 1999 Oct; 181(19):6053-62. . PMID:10498718
Subramanya HS, Arciszewska LK, Baker RA, Bird LE, Sherratt DJ, Wigley DB Crystal structure of the site-specific recombinase, XerD. The EMBO journal. 1997 Sep 01; 16(17):5178-87. . PMID:9311978
Slack FJ, Serror P, Joyce E, Sonenshein AL A gene required for nutritional repression of the Bacillus subtilis dipeptide permease operon. Molecular microbiology. 1995 Feb; 15(4):689-702. . PMID:7783641