ylaK

ylaK
168

similar to phosphate starvation inducible protein [protein|6BF4F99DEF2E032A8547B920086305775D04FACF|phoH]

locus
BSU_14810
Molecular weight
49.17 kDa
pI
5.42
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ylaK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1875 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,549,465  1,550,793
The protein
Protein family
C-terminal part: phoH family (with [protein|6BF4F99DEF2E032A8547B920086305775D04FACF|phoH], according to UniProt)
[wiki|Domains]
PINc domain (aa 3-135) (according to UniProt)
Structure
[PDB|3B85] (aa 233-399, from Corynebacterium glutamicum, 38% identity)
[AF|O07635]
Paralogous protein(s)
[protein|6BF4F99DEF2E032A8547B920086305775D04FACF|phoH], (38%)
Expression and Regulation
Operons
genes
[gene|5913ABC121A03644897BD365D7E507661CD3AF39|ylaK]-[gene|F31DD310F0D80ECC7C6D1E5DDB8EAF32565A3D51|ylaM]
description
[pubmed|22383849]
regulation
expressed during [wiki|sporulation] [pubmed|22383849]
Open in new tab

[gene|5913ABC121A03644897BD365D7E507661CD3AF39|ylaK]->[gene|F31DD310F0D80ECC7C6D1E5DDB8EAF32565A3D51|ylaM]

2025-10-27 13:05:59

Jstuelk

127

56562291fb90c55d7955767be4e0defb22a28699

1D70260F2D1CA55EC99C9F3A1A4F1AB0F4AAC13A

Biological materials
Mutant
MGNA-A540 (ylaK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/540 NBRP B. subtilis, Japan]
BKE14810 ([gene|5913ABC121A03644897BD365D7E507661CD3AF39|ylaK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGTCTCAGCCTCCTGATA,  downstream forward: _UP4_CTTGCAGCTGATTTGCTGTA
BKK14810 ([gene|5913ABC121A03644897BD365D7E507661CD3AF39|ylaK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGTCTCAGCCTCCTGATA,  downstream forward: _UP4_CTTGCAGCTGATTTGCTGTA
References
12762842,12107147

5913ABC121A03644897BD365D7E507661CD3AF39

Page visits: 3418

Time of last update: 2025-10-27 17:28:52

Author of last update: Jstuelk