ylaK
168
similar to phosphate starvation inducible protein [protein|6BF4F99DEF2E032A8547B920086305775D04FACF|phoH]
locus
BSU_14810
Molecular weight
49.17 kDa
pI
5.42
function
unknown
product
unknown
essential
no
synonyms
ylaK
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG1875 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
1,549,465 1,550,793
The protein
Protein family
C-terminal part: phoH family (with [protein|6BF4F99DEF2E032A8547B920086305775D04FACF|phoH], according to UniProt)
[wiki|Domains]
PINc domain (aa 3-135) (according to UniProt)
Structure
[PDB|3B85] (aa 233-399, from Corynebacterium glutamicum, 38% identity)
[AF|O07635]
Paralogous protein(s)
[protein|6BF4F99DEF2E032A8547B920086305775D04FACF|phoH], (38%)
Expression and Regulation
Operons
genes
[gene|5913ABC121A03644897BD365D7E507661CD3AF39|ylaK]-[gene|F31DD310F0D80ECC7C6D1E5DDB8EAF32565A3D51|ylaM]
description
[pubmed|22383849]
regulation
expressed during [wiki|sporulation] [pubmed|22383849]
Biological materials
Mutant
MGNA-A540 (ylaK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/540 NBRP B. subtilis, Japan]
BKE14810 ([gene|5913ABC121A03644897BD365D7E507661CD3AF39|ylaK]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTCTCAGCCTCCTGATA, downstream forward: _UP4_CTTGCAGCTGATTTGCTGTA
BKK14810 ([gene|5913ABC121A03644897BD365D7E507661CD3AF39|ylaK]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTCTCAGCCTCCTGATA, downstream forward: _UP4_CTTGCAGCTGATTTGCTGTA
References
Page visits: 3416
Time of last update: 2025-10-27 17:28:30
Author of last update: Jstuelk