splA

168

transcriptional repressor of the spore photoproduct lyase splA-splB operon

Locus: BSU_13920

Molecular weight: 9.08 kDa

Isoelectric point: 4.42

Protein length: 79 aa

Gene length: 240 bp

Function: regulation of the splA-splB operon

Product: transcriptional regulator

Essential: no

Synonyms: splA, ykxI

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Genetics, DNA repair/ recombination

Information processing, Genetics, DNA repair/ recombination, Other proteins

Information processing, Regulation of gene expression, Transcription factors and their control, Transcription factors/ other

Lifestyles, Sporulation, Sporulation proteins, Sporulation proteins/ other

List of homologs in different organisms

This gene is a member of the following regulons

SigG regulon, SplA regulon

Gene

Coordinates: 1,461,453  1,461,692

The protein

Structure

P37955 (AlphaFold)

Expression and Regulation

Operons

Genes: splA-splB

Description: PubMed

Regulation

expressed during sporulation in the forespore (SigG) PubMed

Regulatory mechanism

SplA: negative autoregulation, in splA regulon

Sigma factors

SigG: sigma factor, PubMed, in sigG regulon

Biological materials

Mutant

BKE13920 (splA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACTATCCCTCCTAGCCA,  downstream forward: _UP4_TAACAAGGAAATCATTACAA
BKK13920 (splA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACTATCCCTCCTAGCCA,  downstream forward: _UP4_TAACAAGGAAATCATTACAA

References

Reviews

Benjdia A DNA photolyases and SP lyase: structure and mechanism of light-dependent and independent DNA lyases. Current opinion in structural biology. 2012 Dec; 22(6):711-20. doi:10.1016/j.sbi.2012.10.002. pii:S0959-440X(12)00161-3. PMID:23164663

Original Publications

Benjdia A, Heil K, Barends TR, Carell T, Schlichting I Structural insights into recognition and repair of UV-DNA damage by Spore Photoproduct Lyase, a radical SAM enzyme. Nucleic acids research. 2012 Oct; 40(18):9308-18. doi:10.1093/nar/gks603. PMID:22761404
Steil L, Serrano M, Henriques AO, Völker U Genome-wide analysis of temporally regulated and compartment-specific gene expression in sporulating cells of Bacillus subtilis. Microbiology (Reading, England). 2005 Feb; 151(Pt 2):399-420. . PMID:15699190
Fajardo-Cavazos P, Nicholson WL The TRAP-like SplA protein is a trans-acting negative regulator of spore photoproduct lyase synthesis during Bacillus subtilis sporulation. Journal of bacteriology. 2000 Jan; 182(2):555-60. . PMID:10629212
Pedraza-Reyes M, Gutiérrez-Corona F, Nicholson WL Temporal regulation and forespore-specific expression of the spore photoproduct lyase gene by sigma-G RNA polymerase during Bacillus subtilis sporulation. Journal of bacteriology. 1994 Jul; 176(13):3983-91. . PMID:8021181

Structure of the spore photoproduct lesion in DNA

Singh I, Jian Y, Lian Y, Li L, Georgiadis MM The structure of an authentic spore photoproduct lesion in DNA suggests a basis for recognition. Acta crystallographica. Section D, Biological crystallography. 2014 Mar; 70(Pt 3):752-9. doi:10.1107/S1399004713032987. PMID:24598744