glcT

168

transcriptional antiterminator, controls expression of the ptsG-ptsH-ptsI operon

Locus: BSU_13880

Molecular weight: 33.03 kDa

Isoelectric point: 7.01

Protein length: 288 aa

Gene length: 867 bp

Function: control of glucose uptake

Product: transcriptional antiterminator of the ptsG-ptsH-ptsI operon

Essential: no

Synonyms: glcT, ykwA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG3711 (Galperin et al., 2021)

Gene

Coordinates: 1,456,092 → 1,456,958

The protein

Catalyzed reaction/ biological activity

• transcription antiterminator , RNA-binding protein, binds the ''ptsG'' RAT sequence

Protein family

• PRD-containing transcription factors

Domains

• RNA-binding domain (N-terminal, constitutive antiterminator)
• 2x PTS regulation domains (PRDs) (C-terminal, neg. regulated by PtsG)

Structure

• 3RIO (PDB) (RBD-PRD-I) PubMed
• 3GWH (PDB) (PRD-II) PubMed
• O31691 (AlphaFold)

Modification

• phosphorylation (His104)

Paralogous protein(s)

• SacY, LicT, SacT

Expression and Regulation

Operons

• Genes: papB-ykvZ-glcT

  Description: PubMed

Biological materials

Mutant

• available in Jörg Stülke's lab:
• GP109 (ΔglcT, in frame deletion)
• GP778 (ΔglcT-ptsG-ptsH-ptsI::spc) PubMed
• GP926 (ΔglcT-ptsG::tet) PubMed
• BKE13880 (ΔglcT::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCAATACCTCATATCGT,  downstream forward: _UP4_TAAATTCAGTTTATCCTTAT
• BKK13880 (ΔglcT::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCAATACCTCATATCGT,  downstream forward: _UP4_TAAATTCAGTTTATCCTTAT

Expression vectors

• pGP124 (full length, in pWH844), available in Jörg Stülke's lab
• pGP114 (amino acids 1-60, RNA-binding domain, in pWH844), available in Jörg Stülke's lab
• pGP230 (amino acids 1-60, RNA-binding domain with thrombin cleavage site, in pWH844), available in Jörg Stülke's lab
• pGP164 (both PRDs, in pWH844), in addition diverse Expression vector for phosphorylation site mutants and for RBD mutants (all in pWH844), available in Jörg Stülke's lab
• pGP424 (PRDI, in pWH844), available in Jörg Stülke's lab
• pGP425 (PRDII, in pWH844), available in Jörg Stülke's lab
• pGP442 (PRDI, in pGP570, with thrombin cleavage site), available in Jörg Stülke's lab
• pGP443 (PRDII, in pGP570,  with thrombin cleavage site), available in Jörg Stülke's lab
• pGP575 (amino acids 1-60, RNA-binding domain with Strep-tag, in pGP574), available in Jörg Stülke's lab

FLAG-tag construct

• GP1220 (spc, based on pGP1331), available in Jörg Stülke's lab

GFP fusion

• GP1224 (spc, based on pGP1870), available in Jörg Stülke's lab

Labs working on this gene/protein

• Jörg Stülke, University of Göttingen, Germany Homepage

References

Reviews

Loading

Original Publications

Loading