ykvO

168

similar to glucose 1-dehydrogenase

Locus: BSU_13770

Molecular weight: 26.10 kDa

Isoelectric point: 4.56

Protein length: 248 aa

Gene length: 747 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: ykvO

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1028 (Galperin et al., 2021)

Gene

Coordinates: 1,442,872  1,443,618

The protein

Protein family

• Short-chain dehydrogenases/reductases (SDR) family (according to UniProt)

Structure

• 4FGS (PDB) (from Rhizobium etli, 57% identity)
• O31680 (AlphaFold)

Paralogous protein(s)

• YxbG, BacC, FabG
• FabL, (31,8%)
• YhxC, (32,5%)
• YhxD, (34,5%)
• YcdF, (31,9%)
• Gdh, (34,8%)
• FadH, (33,6%)
• YhdF, (35,1%)
• YdaD, (37.5%),

Expression and Regulation

Operons

• Genes: ykvO

  Description: PubMed

Biological materials

Mutant

• MGNA-B327 (ykvO::erm), available at the NBRP B. subtilis, Japan
• BKE13770 (ykvO::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACTTAACACTCCTTTAG,  downstream forward: _UP4_TAATTTCACTGCGCAGAGAT
• BKK13770 (ykvO::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATACTTAACACTCCTTTAG,  downstream forward: _UP4_TAATTTCACTGCGCAGAGAT