ykoT

168

similar to lipoteichoic acid glycosyltransferase

Locus: BSU_13390

Molecular weight: 38.36 kDa

Isoelectric point: 9.34

Protein length: 337 aa

Gene length: 1014 bp

Function: unknown

Product: unknown

Essential: no

Synonyms: ykoT

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0463 (Galperin et al., 2021)

Gene

Coordinates: 1,403,479 → 1,404,492

The protein

Protein family

• glycosyltransferase 2 family (according to UniProt)

Structure

• 5EKP (PDB) (from Synechocystis sp., 38% identity) PubMed
• O34755 (AlphaFold)

Paralogous protein(s)

• CsbB
• YkcC, (39%)

Localization

• cell membrane (heterogeneous) PubMed

Expression and Regulation

Operons

• Genes: ykoS-ykoT

  Description: PubMed

  Regulation

  • expressed late during sporulation in the forespore (SigG, SpoVT) PubMed

  Regulatory mechanism

  • SpoVT: repression, PubMed, in spoVT regulon

  Sigma factors

  • SigG: sigma factor, PubMed, in sigG regulon

Biological materials

Mutant

• MGNA-A777 (ykoT::erm), available at the NBRP B. subtilis, Japan
• BKE13390 (ΔykoT::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TGACTGTTTCAATCGATATC,  downstream forward: _UP4_TAAACACGGAAAGAGCTGAC
• BKK13390 (ΔykoT::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TGACTGTTTCAATCGATATC,  downstream forward: _UP4_TAAACACGGAAAGAGCTGAC

References

Percy MG, Karinou E, Webb AJ, Gründling A Identification of a Lipoteichoic Acid Glycosyltransferase Enzyme Reveals that GW-Domain-Containing Proteins Can Be Retained in the Cell Wall of Listeria monocytogenes in the Absence of Lipoteichoic Acid or Its Modifications. Journal of bacteriology. 2016 Aug 01; 198(15):2029-42. doi:10.1128/JB.00116-16. PMID:27185829
Ardiccioni C, Clarke OB, Tomasek D, Issa HA, von Alpen DC, Pond HL, Banerjee S, Rajashankar KR, Liu Q, Guan Z, Li C, Kloss B, Bruni R, Kloppmann E, Rost B, Manzini MC, Shapiro L, Mancia F Structure of the polyisoprenyl-phosphate glycosyltransferase GtrB and insights into the mechanism of catalysis. Nature communications. 2016 Jan 05; 7:10175. doi:10.1038/ncomms10175. PMID:26729507
Arrieta-Ortiz ML, Hafemeister C, Bate AR, Chu T, Greenfield A, Shuster B, Barry SN, Gallitto M, Liu B, Kacmarczyk T, Santoriello F, Chen J, Rodrigues CD, Sato T, Rudner DZ, Driks A, Bonneau R, Eichenberger P An experimentally supported model of the Bacillus subtilis global transcriptional regulatory network. Molecular systems biology. 2015 Nov 17; 11(11):839. doi:10.15252/msb.20156236. PMID:26577401
Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B, Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P, Noirot P Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science (New York, N.Y.). 2012 Mar 02; 335(6072):1103-6. doi:10.1126/science.1206848. PMID:22383849
Marchadier E, Carballido-López R, Brinster S, Fabret C, Mervelet P, Bessières P, Noirot-Gros MF, Fromion V, Noirot P An expanded protein-protein interaction network in Bacillus subtilis reveals a group of hubs: Exploration by an integrative approach. Proteomics. 2011 Aug; 11(15):2981-91. doi:10.1002/pmic.201000791. PMID:21630458
Meile JC, Wu LJ, Ehrlich SD, Errington J, Noirot P Systematic localisation of proteins fused to the green fluorescent protein in Bacillus subtilis: identification of new proteins at the DNA replication factory. Proteomics. 2006 Apr; 6(7):2135-46. . PMID:16479537