ykfC

168

D-glutamyl-L-amino acid peptidase

Locus: BSU_12990

Molecular weight: 32.91 kDa

Isoelectric point: 6.35

Protein length: 296 aa

Gene length: 891 bp

Function: cell wall metabolism

Product: D-glutamyl-L-amino acid peptidase

Essential: no

Synonyms: ykfC

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0791 (Galperin et al., 2021)

Gene

Coordinates: 1,367,941 → 1,368,831

The protein

Catalyzed reaction/ biological activity

• cleaves L-Ala-γ-D-Glu dipeptides from cell wall peptides PubMed
• The enzyme releases L-Ala-gamma-D-Glu dipeptides from cell wall peptides via cleavage of an L-Ala-gamma-D-Glu-|-L-Lys bond (according to UniProt)

Protein family

• Peptidase C40 family (according to UniProt)

Structure

• 3H41 (PDB) (from B. cereus, 39% identity) PubMed
• O35010 (AlphaFold)

Expression and Regulation

Operons

• Genes: dppA-dppB-dppC-dppD-dppE-ykfA-ykfB-ykfC-ykfD

  Description: PubMed

  Regulatory mechanism

  • CodY: repression, PubMed, in codY regulon

Biological materials

Mutant

• MGNA-A742 (ykfC::erm), available at the NBRP B. subtilis, Japan
• BKE12990 (ΔykfC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACTGCTGATATGACAGTGT,  downstream forward: _UP4_TTTTCAGAATAAGGAGGGAG
• BKK12990 (ΔykfC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACTGCTGATATGACAGTGT,  downstream forward: _UP4_TTTTCAGAATAAGGAGGGAG

References

Reviews

Gilmore MC, Cava FBacterial peptidoglycan recycling.Trends in microbiology. 2024 Nov 28; . PMID: 39613687

Original Publications

Xu Q, Abdubek P, Astakhova T, Axelrod HL, Bakolitsa C, Cai X, Carlton D, Chen C, Chiu HJ, Chiu M, Clayton T, Das D, Deller MC, Duan L, Ellrott K, Farr CL, Feuerhelm J, Grant JC, Grzechnik A, Han GW, Jaroszewski L, Jin KK, Klock HE, Knuth MW, Kozbial P, Krishna SS, Kumar A, Lam WW, Marciano D, Miller MD, Morse AT, Nigoghossian E, Nopakun A, Okach L, Puckett C, Reyes R, Tien HJ, Trame CB, van den Bedem H, Weekes D, Wooten T, Yeh A, Hodgson KO, Wooley J, Elsliger MA, Deacon AM, Godzik A, Lesley SA, Wilson IA Structure of the γ-D-glutamyl-L-diamino acid endopeptidase YkfC from Bacillus cereus in complex with L-Ala-γ-D-Glu: insights into substrate recognition by NlpC/P60 cysteine peptidases. Acta crystallographica. Section F, Structural biology and crystallization communications. 2010 Oct 01; 66(Pt 10):1354-64. doi:10.1107/S1744309110021214. PMID:20944232
Molle V, Nakaura Y, Shivers RP, Yamaguchi H, Losick R, Fujita Y, Sonenshein AL Additional targets of the Bacillus subtilis global regulator CodY identified by chromatin immunoprecipitation and genome-wide transcript analysis. Journal of bacteriology. 2003 Mar; 185(6):1911-22. . PMID:12618455