xkdO

168

PBSX prophage, putative cell wall hydrolase (N-acetylglucosamidase)

Locus: BSU_12680

Molecular weight: 144.92 kDa

Isoelectric point: 10.1

Protein length: 1332 aa

Gene length: 3999 bp

Function: unknown

Product: unknown

Essential: no

E.C.: null

Synonyms: xkdO

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Cell envelope and cell division, Cell wall/ other/ based on similarity

Prophages and mobile genetic elements, Prophages, PBSX prophage

List of homologs in different organisms, belongs to COG3953 (Galperin et al., 2021)

This gene is a member of the following regulons

Xpf regulon

Gene

Coordinates: 1,334,966 → 1,338,964

The protein

Structure

P54334 (AlphaFold)

Expression and Regulation

Operons

Genes: xtmA-xtmB-xkdE-xkdF-xkdG-xkdH-xkdI-xkdJ-xkdK-xkdM-xkdN-xkzB-xkdO-xkdP-xkdQ-xkdR-xkdS-xkdT-xkdU-xkzA-xkdV-xkdW-xkdX-xepA-xhlA-xhlB-xlyA

Description: PubMed

Regulation

expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

Sigma factors

Xpf: sigma factor, PubMed, in xpf regulon

Biological materials

Mutant

BKE12680 (ΔxkdO::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AAAACGGGCTGTTAATTTTG,  downstream forward: _UP4_ATTGGAACGAAGGGAGTCGT
BKK12680 (ΔxkdO::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_AAAACGGGCTGTTAATTTTG,  downstream forward: _UP4_ATTGGAACGAAGGGAGTCGT