exuT

168

galacturonate transport in via proton symport, glucuronate transport in via proton symport

Locus: BSU_12360

Molecular weight: 45.15 kDa

Isoelectric point: 9.61

Protein length: 422 aa

Gene length: 1269 bp

Function: hexuronate uptake

Product: hexuronate transporter

Essential: no

Synonyms: exuT, yjmG

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, Transporters/ other, Carbohydrate transporter

Metabolism, Carbon metabolism, Utilization of specific carbon sources, Utilization of hexuronate

Lifestyles, Sporulation, Sporulation proteins, Sporulation proteins/ other

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG2271 (Galperin et al., 2021)

This gene is a member of the following regulons

SigE regulon, SigA regulon, CcpA regulon, ExuR regulon

Gene

Coordinates: 1,307,446  1,308,714

The protein

Protein family

major facilitator superfamily (according to UniProt)

Structure

6E9N (PDB) (from E. coli, 30% identity) PubMed
O34456 (AlphaFold)

Localization

cell membrane (according to Swiss-Prot)

Expression and Regulation

Operons

Genes: yjmC-yjmD-uxuA-yjmF-exuT-exuR-uxaB-uxaA

Description: PubMed

Regulation

induced by galacturonate (ExuR) PubMed

Regulatory mechanism

ExuR: repression, in the absence of inducer, in exuR regulon
CcpA: repression, PubMed PubMed, in ccpA regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon
SigE: sigma factor, PubMed, in sigE regulon

Genes: uxaC-yjmB-yjmC-yjmD-uxuA-yjmF-exuT-exuR-uxaB-uxaA

Description: PubMed

Regulation

induced by galacturonate (ExuR) PubMed

Regulatory mechanism

ExuR: repression, in the absence of inducer, in exuR regulon
CcpA: repression, PubMed PubMed, in ccpA regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

MGNA-A371 (yjmG::erm), available at the NBRP B. subtilis, Japan
BKE12360 (exuT::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTCAACCTCACCCCTAT,  downstream forward: _UP4_TAATCTGGAAATATAGTGGG
BKK12360 (exuT::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTCAACCTCACCCCTAT,  downstream forward: _UP4_TAATCTGGAAATATAGTGGG

References

Loading