yjcL

168

unknown

Locus: BSU_11900

Molecular weight: 43.16 kDa

Isoelectric point: 9.38

Protein length: 396 aa

Gene length: 1191 bp

Function: unknown

Product: unknown

Essential: no

E.C.: null

Synonyms: yjcL

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Groups of genes, Proteins of unknown function

List of homologs in different organisms, belongs to COG5505 (Galperin et al., 2021)

Gene

Coordinates: 1,261,426  1,262,616

The protein

Structure

O31634 (AlphaFold)

Expression and Regulation

Operons

Genes: yjcL-yjcK

Description: PubMed

Expression

expression is increased upon depletion of depletion of tRNA maturation factors rnpB or rnz PubMed

Biological materials

Mutant

MGNA-B258 (yjcL::erm), available at the NBRP B. subtilis, Japan
BP138 (''yjcL::spc'') available in Fabian Commichau's lab
BP139 (''yjcL-yjcK::ermC''), available in Fabian Commichau's lab
BKE11900 (yjcL::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAAAACCCCATCACCTCTAT,  downstream forward: _UP4_TAAAAAGGATATTTGCATTT
BKK11900 (yjcL::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAAAACCCCATCACCTCTAT,  downstream forward: _UP4_TAAAAAGGATATTTGCATTT

References

Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B, Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P, Noirot P Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science (New York, N.Y.). 2012 Mar 02; 335(6072):1103-6. doi:10.1126/science.1206848. PMID:22383849