ntdC

ntdC
168

NAD-dependent glucose-6-phosphate dehydrogenase

Locus
BSU_10530
Molecular weight
39.14 kDa
Isoelectric point
6.23
Protein length
Gene length
Function
synthesis of the antibiotic kanosamine
Product
NAD-dependent glucose-6-phosphate dehydrogenase
Essential
no
Synonyms
ntdC, yhjJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0673 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
1,126,400  1,127,452
The protein
Catalyzed reaction/ biological activity
glucose-6-phosphate + NAD - 3-oxo-d-glucose-6-phosphate + NADH(2) PubMed
Protein family
Gfo/Idh/MocA family (according to UniProt)
NAD+ PubMed
Structure
3EUW (PDB) (from Corynebacterium glutamicum, 21% identity)
Paralogous protein(s)
Expression and Regulation
Operons
Description
Regulation
induced by 3,3'-neotrehalosadiamine and kanosamine (NtdR) PubMed
Regulatory mechanism
NtdR: activation , in ntdR regulon
Sigma factors
SigA: sigma factor, PubMed, in sigA regulon
Open in new tab

ntdAglcP

2025-10-20 21:05:02

Jstuelk

151

41B772604ED3B8BA7F5F0AFF19B989A8E4F9FDC1

2A657E0F29C43EAF1C8F99F810D2B0756ABA88B3

Biological materials
Mutant
MGNA-B286 (yhjJ::erm), available at the NBRP B. subtilis, Japan
BKE10530 (ntdC::erm  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CATTTTTATTTCCTCCTCAT,  downstream forward: _UP4_TAGTATTTCAAAGAGAGAAG
BKK10530 (ntdC::kan  trpC2) available at BGSCPubMed, upstream reverse: _UP1_CATTTTTATTTCCTCCTCAT,  downstream forward: _UP4_TAGTATTTCAAAGAGAGAAG
References
Reviews
Loading
Original Publications
Loading

29DAF5343A42EAD8DB97925FE7D049410F7B7FCA

Page visits: 3543

Time of last update: 2025-10-22 03:07:27

Author of last update: Jstuelk