lcfB

168

long-chain fatty-acid-CoA ligase, involved in surfactin production

Locus: BSU_10270

Molecular weight: 56.41 kDa

Isoelectric point: 5.3

Protein length: 513 aa

Gene length: 1542 bp

Function: fatty acid degradation

Product: long-chain fatty-acid-CoA ligase

Essential: no

E.C.: 6.2.1.3

Synonyms: lcfB, yhfL

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Lipid metabolism, Utilization of lipids, Utilization of fatty acids

List of homologs in different organisms, belongs to COG0318 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, CcpA regulon, FadR regulon, RoxS regulon

Gene

Coordinates: 1,100,980  1,102,521

The protein

Catalyzed reaction/ biological activity

long-chain fatty acid + ATP + CoA --> long-chain fatty acyl-CoA + AMP + diphosphate (according to UniProt)
activates 3-hydroxy fatty acids for surfactin biosynthesis PubMed

Protein family

ATP-dependent AMP-binding enzyme family (according to UniProt)

Structure

3R44 (PDB) (Very-long-chain fatty acyl-CoA synthetase from Mycobacterium tuberculosis, 35% identity) PubMed
O07610 (AlphaFold)

Paralogous protein(s)

YhfT, YngI, LcfA

Expression and Regulation

Operons

Genes: lcfB

Description: PubMed

Regulation

induced in the presence of long-chain fatty acids (FadR) PubMed
down-regulated in response to RoxS overexpression PubMed

Regulatory mechanism

FadR: repression, PubMed, in fadR regulon
CcpA: repression, in ccpA regulon
RoxS: sRNA, PubMed, in roxS regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

MGNA-B277 (yhfL::erm), available at the NBRP B. subtilis, Japan
available in Mohamed Marahiel's lab PubMed
BKE10270 (lcfB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCTCCCACCCCTTAAGT,  downstream forward: _UP4_TAAAATGAAAAAGCGAAGCG
BKK10270 (lcfB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTCTCCCACCCCTTAAGT,  downstream forward: _UP4_TAAAATGAAAAAGCGAAGCG

References

Andersson CS, Lundgren CA, Magnúsdóttir A, Ge C, Wieslander A, Martinez Molina D, Högbom M The Mycobacterium tuberculosis very-long-chain fatty acyl-CoA synthetase: structural basis for housing lipid substrates longer than the enzyme. Structure (London, England : 1993). 2012 Jun 06; 20(6):1062-70. doi:10.1016/j.str.2012.03.012. PMID:22560731
Kraas FI, Helmetag V, Wittmann M, Strieker M, Marahiel MA Functional dissection of surfactin synthetase initiation module reveals insights into the mechanism of lipoinitiation. Chemistry & biology. 2010 Aug 27; 17(8):872-80. doi:10.1016/j.chembiol.2010.06.015. PMID:20797616
Fujita Y, Matsuoka H, Hirooka K Regulation of fatty acid metabolism in bacteria. Molecular microbiology. 2007 Nov; 66(4):829-39. . PMID:17919287
Matsuoka H, Hirooka K, Fujita Y Organization and function of the YsiA regulon of Bacillus subtilis involved in fatty acid degradation. The Journal of biological chemistry. 2007 Feb 23; 282(8):5180-94. . PMID:17189250