pbpF

168

forespore-specific class A penicillin-binding protein 2C

Locus: BSU_10110

Molecular weight: 79.10 kDa

Isoelectric point: 7.08

Protein length: 714 aa

Gene length: 2145 bp

Function: bifunctional glucosyltransferase/ transpeptidase, synthesis of spore peptidoglycan

Product: forespore-specific penicillin-binding protein 2C

Essential: no

Synonyms: pbpF

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0744 (Galperin et al., 2021)

Gene

Coordinates: 1,083,851  1,085,995

Phenotypes of a mutant

• a strain lacking all four class A penicillin-binding proteins (ponA pbpD pbpF pbpG) is severely inhibited for L-form switching in the presence of D-cycloserine PubMed
• a pbpG pbpF double mutant results in abberant deposition of the spore cortex PubMed

The protein

Catalyzed reaction/ biological activity

• synthesis of spore peptidoglycan (with PbpG) PubMed
• [GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)]_(n)-diphospho-di-trans,octa-cis-undecaprenol + β-D-GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)-diphospho-di-trans,octa-cis-undecaprenol = [GlcNAc-(1→4)-Mur2Ac(oyl-L-Ala-γ-D-Glu-L-Lys-D-Ala-D-Ala)]_(n+1)-diphospho-di-trans-octa-cis-undecaprenol + di-trans,octa-cis-undecaprenyl diphosphate + H⁺ (according to UniProt)
• Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala. Also transpeptidation of peptidyl-alanyl moieties that are N-acyl substituents of D-alanine (according to UniProt)

Protein family

• N-terminal part: glycosyltransferase 51 family (according to UniProt)
• C-terminal part: transpeptidase family (according to UniProt)

Structure

• 2OLU (PDB) (from Staphylococcus aureus, aa 40-610, 32% identity) PubMed
• P38050 (AlphaFold)

Paralogous protein(s)

• PbpD, PbpG, PonA

Localization

• cell membrane, the major part is exposed to the outside (according to UniProt)
• forespore PubMed
• during vegetative growth: septal, low flourescence at periphery PubMed

Expression and Regulation

Operons

• Genes: pbpF

  Description: PubMed

  Regulation

  • expressed in mother cell and prespore PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigG: sigma factor, PubMed, in sigG regulon

Biological materials

Mutant

• BKE10110 (pbpF::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGAACTCACCTCGCCTTT,  downstream forward: _UP4_TAATGGAATTCGGCGATTTT
• BKK10110 (pbpF::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGAACTCACCTCGCCTTT,  downstream forward: _UP4_TAATGGAATTCGGCGATTTT

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jeff Errington lab

GFP fusion

• 2084 trpC2 pbpF::pSG1491 (cat P_xyl-gfpa-pbpF1-335) PubMed, available in Dirk Jan Scheffers' lab and in the BGSC

References

Reviews

Loading

Original Publications

Loading