sbcE

168

SMC-like protein, involved in DNA double-strand break repair and competence

Locus: BSU_09920

Molecular weight: 110.96 kDa

Isoelectric point: 5.79

Protein length: 963 aa

Gene length: 2892 bp

Function: DNA double-strand break repair and competence

Product: SMC-like protein

Essential: no

Synonyms: sbcE, yhaN

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG4717 (Galperin et al., 2021)

Gene

Coordinates: 1,066,077  1,068,968

Phenotypes of a mutant

• sensitive to DNA damage PubMed

The protein

Structure

• O08455 (AlphaFold)

Localization

• Membrane-proximal (Spotty) PubMed

Expression and Regulation

Operons

• Genes: yhaO-sbcE-yhaM

  Description: PubMed

  Regulation

  • induced by DNA damage (LexA) PubMed

  Regulatory mechanism

  • LexA: repression, PubMed, in lexA regulon

Biological materials

Mutant

• GP3528 (ΔsbcE::spec), available in Jörg Stülke's lab
• MGNA-A663 (yhaN::erm), available at the NBRP B. subtilis, Japan
• BKE09920 (sbcE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TATAATTCGCAAAGCTGTCA,  downstream forward: _UP4_TAAAAGAGGTTCTATAGCTG
• BKK09920 (sbcE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TATAATTCGCAAAGCTGTCA,  downstream forward: _UP4_TAAAAGAGGTTCTATAGCTG

References

Krishnamurthy M, Tadesse S, Rothmaier K, Graumann PL A novel SMC-like protein, SbcE (YhaN), is involved in DNA double-strand break repair and competence in Bacillus subtilis. Nucleic acids research. 2010 Jan; 38(2):455-66. doi:10.1093/nar/gkp909. PMID:19906728
Jung K, Jung H A new mechanism of phosphoregulation in signal transduction pathways. Science signaling. 2009 Nov 10; 2(96):pe71. doi:10.1126/scisignal.296pe71. PMID:19903937
Meile JC, Wu LJ, Ehrlich SD, Errington J, Noirot P Systematic localisation of proteins fused to the green fluorescent protein in Bacillus subtilis: identification of new proteins at the DNA replication factory. Proteomics. 2006 Apr; 6(7):2135-46. . PMID:16479537
Au N, Kuester-Schoeck E, Mandava V, Bothwell LE, Canny SP, Chachu K, Colavito SA, Fuller SN, Groban ES, Hensley LA, O'Brien TC, Shah A, Tierney JT, Tomm LL, O'Gara TM, Goranov AI, Grossman AD, Lovett CM Genetic composition of the Bacillus subtilis SOS system. Journal of bacteriology. 2005 Nov; 187(22):7655-66. . PMID:16267290