yhcE

168

similar to ABC transporter (membrane protein)

Locus: BSU_09050

Molecular weight: 29.31 kDa

Isoelectric point: 9.72

Protein length: 253 aa

Gene length: 762 bp

Function: unknown

Product: ABC transporter (membrane protein)

Essential: no

Synonyms: yhcE

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, ABC transporters, Exporters, Exporters of unknown function

Groups of genes, Membrane proteins

List of homologs in different organisms

Gene

Coordinates: 980,473  981,234

The protein

Structure

P54589 (AlphaFold)

Localization

cell membrane (according to UniProt)

Expression and Regulation

Operons

Genes: yhcE-yhcF-yhcG-yhcH-yhcI

Description: PubMed

Biological materials

Mutant

MGNA-A658 (yhcE::erm), available at the NBRP B. subtilis, Japan
BKE09050 (yhcE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TAAACCTAAAAAAGAATTCA,  downstream forward: _UP4_GATCGTAAAGTAGAGGTGTA
BKK09050 (yhcE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TAAACCTAAAAAAGAATTCA,  downstream forward: _UP4_GATCGTAAAGTAGAGGTGTA

References

Mahendran A, Orlando BJGenome wide structural prediction of ABC transporter systems in Bacillus subtilis.Frontiers in microbiology. 2024; 15:1469915. PMID: 39397791
Lehnik-Habrink M, Schaffer M, Mäder U, Diethmaier C, Herzberg C, Stülke J RNA processing in Bacillus subtilis: identification of targets of the essential RNase Y. Molecular microbiology. 2011 Sep; 81(6):1459-73. doi:10.1111/j.1365-2958.2011.07777.x. PMID:21815947
Quentin Y, Fichant G, Denizot F Inventory, assembly and analysis of Bacillus subtilis ABC transport systems. Journal of molecular biology. 1999 Apr 02; 287(3):467-84. . PMID:10092453