ygaD

168

ABC transporter for the export of polymiyxin B (fused ATP-binding and membrane protein)

Locus: BSU_08690

Molecular weight: 66.59 kDa

Isoelectric point: 7.03

Protein length: 589 aa

Gene length: 1770 bp

Function: export of polymiyxin B

Product: ABC-type exporter for polymyxin B

Essential: no

Synonyms: ygaD

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1132 (Galperin et al., 2021)

Gene

Coordinates: 939,322  941,091

Phenotypes of a mutant

• increased sensitivity to polymyxin B PubMed

The protein

Catalyzed reaction/ biological activity

• binding and export of polymyxin B PubMed

Protein family

• ABC transporter superfamily (according to UniProt)

Domains

• has both a membrane-spanning and an ATP-binding domain PubMed
• ABC transmembrane type-1 domain (aa 19-307) (according to UniProt)
• ABC transporter domain (aa 341-576) (according to UniProt)

Structure

• 2HYD (PDB) (from Staphylococcus aureus, 61% identity) PubMed
• P71082 (AlphaFold)

Paralogous protein(s)

• YfiB, BmrC, YknU, BmrD, YknV, YwjA, YfiC, BmrA

Localization

• cell membrane PubMed

Expression and Regulation

Operons

• Genes: ygaC-ygaD

  Description: PubMed

Biological materials

Mutant

• MGNA-A244 (ygaD::erm), available at the NBRP B. subtilis, Japan
• BKE08690 (ygaD::erm  trpC2) available at BGSC and in Jörg Stülke's lab,  PubMed, upstream reverse: _UP1_CACGGTTGATTCCCCCTCTC,  downstream forward: _UP4_TAAAACATCAATCTTATATC
• BKK08690 (ygaD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGGTTGATTCCCCCTCTC,  downstream forward: _UP4_TAAAACATCAATCTTATATC

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

References

Loading