int

168

integrase

Locus: BSU_04800

Molecular weight: 43.32 kDa

Isoelectric point: 9.76

Protein length: 368 aa

Gene length: 1107 bp

Function: excision of the conjugative transposon ICEBs1 from the trnS-leu2 locus

Product: integrase

Essential: no

Synonyms: int, ydcL

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG4974 (Galperin et al., 2021)

Gene

Coordinates: 529,505  530,611

The protein

Protein family

• phage integrase family (according to UniProt)

Structure

• 4A8E (PDB) (from Pyrococcus abyssi, 25% identity) PubMed
• P96629 (AlphaFold)

Expression and Regulation

Operons

• Genes: immR-immA-int

  Description: PubMed

Biological materials

Mutant

• BKE04800 (int::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTATTTCTCCTTTAAC,  downstream forward: _UP4_TAGGTAAGTGGGCAGTTTGT
• BKK04800 (int::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTATTTCTCCTTTAAC,  downstream forward: _UP4_TAGGTAAGTGGGCAGTTTGT

References

Serre MC, El Arnaout T, Brooks MA, Durand D, Lisboa J, Lazar N, Raynal B, van Tilbeurgh H, Quevillon-Cheruel S The carboxy-terminal αN helix of the archaeal XerA tyrosine recombinase is a molecular switch to control site-specific recombination. PloS one. 2013; 8(5):e63010. doi:10.1371/journal.pone.0063010. PMID:23667562
Lee CA, Auchtung JM, Monson RE, Grossman AD Identification and characterization of int (integrase), xis (excisionase) and chromosomal attachment sites of the integrative and conjugative element ICEBs1 of Bacillus subtilis. Molecular microbiology. 2007 Dec; 66(6):1356-69. . PMID:18005101