phrC

168

response regulator aspartate phosphatase (RapC) regulator / competence and sporulation stimulating factor (CSF)

Locus: BSU_03780

Molecular weight: 4.06 kDa

Isoelectric point: 8.16

Protein length: 40 aa

Gene length: 123 bp

Function: control of ComA activity

Product: phosphatase (RapC) regulator / competence and sporulation stimulating factor (CSF)

Essential: no

E.C.: null

Synonyms: phrC

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Genetics, Genetic competence

Information processing, Regulation of gene expression, Transcription factors and their control, Control of two-component response regulators, Control of response regulators/ other

Information processing, Regulation of gene expression, Quorum sensing

Lifestyles, Exponential and early post-exponential lifestyles, Genetic competence

Groups of genes, Short peptides

List of homologs in different organisms

This gene is a member of the following regulons

SigA regulon, CcpA regulon, CodY regulon, ComA regulon, SigH regulon

Gene

Coordinates: 429,963 → 430,085

The protein

Catalyzed reaction/ biological activity

binds to RapC, this results in the inability of RapC to interact with ComA PubMed

Protein family

phr family (according to UniProt)

Structure

4GYO (PDB) (complex RapJ-PhrC) PubMed
P94416 (AlphaFold)

Expression and Regulation

Operons

Genes: rapC-phrC

Description: PubMed

Regulation

expressed at high cell density (ComA) PubMed

Regulatory mechanism

CodY: repression, PubMed, in codY regulon
ComA: activation, (ComA) PubMed, in comA regulon
CcpA: repression, PubMed, in ccpA regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon
SigH: sigma factor, PubMed, in sigH regulon

Genes: phrC

Description: PubMed

Regulation

expressed at high cell density (ComA) PubMed

Biological materials

Mutant

BKE03780 (ΔphrC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ACTTAGATTTCAATTTCATA,  downstream forward: _UP4_TAAGAACAAGCCCCTTCTCA
BKK03780 (ΔphrC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ACTTAGATTTCAATTTCATA,  downstream forward: _UP4_TAAGAACAAGCCCCTTCTCA

References

Reviews

Loading

Original Publications

Loading