lctP

lctP
168

lactate permease, excretion

locus
BSU_03060
Molecular weight
57.49 kDa
pI
9.77
Protein length
Gene length
function
lactate excretion
product
L-lactate permease
essential
no
synonyms
lctP, ycgC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1620 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
330,771  332,396
The protein
Protein family
lactate permease family (with [protein|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP], according to UniProt)
Structure
[AF|P55910]
Paralogous protein(s)
[protein|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|A0DD68FE90FD13DF03496321AB2DAAADF9F4230D|ldh]-[gene|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]
description
[Pubmed|16207915]
regulation
induced under anaerobic conditions ([protein|search|Rex]) [Pubmed|16207915]
regulatory mechanism
[protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]: repression, [Pubmed|16207915], in [regulon|protein:B5EF521437323EF43F08E5EFDB5C798616CA499A|rex regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10809684], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|A0DD68FE90FD13DF03496321AB2DAAADF9F4230D|ldh]→[gene|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]

2025-10-23 07:37:42

ghost

153

4e780837233d2e8aaeda4442db171cadf439e394

20AF87A98A20E424287B9BFAEFDE8827032D1500

Biological materials
Mutant
BKE03060 ([gene|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGACAATCAGCCCTTTA,  downstream forward: _UP4_TAATAGAAAAAAGCAGTACA
BKK03060 ([gene|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03060 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTGACAATCAGCCCTTTA,  downstream forward: _UP4_TAATAGAAAAAAGCAGTACA
GP2578 ([gene|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]::tet comIQ12L) (in DK1042) available in [wiki|Jörg Stülke]'s lab
References
16207915,10809684,16428414,17573341

84D391ED4E81BC17FC2A115985962445D7996DFA

Page visits: 5855

Time of last update: 2025-10-25 11:10:22

Author of last update: Melvin.boenninger