petA

168

phosphatidylethanolamine transporter, distribution of phosphatidylethanolamine between inner and outer leaflets of the membrane

Locus: BSU_02280

Molecular weight: 18.20 kDa

Isoelectric point: 9.48

Protein length: 162 aa

Gene length: 489 bp

Function: export of phosphatidylethanolamine

Product: phosphatidylethanolamine transporter

Essential: no

Synonyms: ybfM

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0586 (Galperin et al., 2021)

Gene

Coordinates: 248,268 → 248,756

Phenotypes of a mutant

• increased resistance to duramycin PubMed

The protein

Catalyzed reaction/ biological activity

• export of phosphatidylethanolamine to the outer side of the cell membrane PubMed

Protein family

• dedA family (with UptA and YkoX, according to UniProt) PubMed

Structure

• O31453 (AlphaFold)

Paralogous protein(s)

• UptA
• YkoX, (30%)

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: ybfK-pssA-petA-psd

  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigX: sigma factor, PubMed, in sigX regulon

Biological materials

Mutant

• BKE02280 (ΔpetA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_GTAATCCGCTATGAGCTGCT,  downstream forward: _UP4_ATCGGAAGGGTTATAGGGAT
• BKK02280 (ΔpetA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_GTAATCCGCTATGAGCTGCT,  downstream forward: _UP4_ATCGGAAGGGTTATAGGGAT

Reviews

Doerrler WT, Sikdar R, Kumar S, Boughner LANew functions for the ancient DedA membrane protein family.Journal of bacteriology. 2013 Jan; 195(1):3-11. PMID: 23086209

References

Roney IJ, Rudner DZThe DedA superfamily member PetA is required for the transbilayer distribution of phosphatidylethanolamine in bacterial membranes.Proceedings of the National Academy of Sciences of the United States of America. 2023 May 16; 120(20):e2301979120. PMID: 37155911
Cao M, Helmann JD The Bacillus subtilis extracytoplasmic-function sigmaX factor regulates modification of the cell envelope and resistance to cationic antimicrobial peptides. Journal of bacteriology. 2004 Feb; 186(4):1136-46. . PMID:14762009