feuB

168

ABC transporter for the siderophores Fe-enterobactin and Fe-bacillibactin (integral membrane protein)

Locus: BSU_01620

Molecular weight: 35.74 kDa

Isoelectric point: 9.54

Protein length: 334 aa

Gene length: 1005 bp

Function: acquisition of iron

Product: ABC transporter for the siderophores Fe-enterobactin and Fe-bacillibactin (integral membrane protein)

Essential: no

Synonyms: feuB

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, ABC transporters, Importers, Uptake of iron/ siderophores

Cellular processes, Homeostasis, Acquisition of iron, ABC transporters for the uptake of iron/ siderophores

Metabolism, Additional metabolic pathways, Iron metabolism, ABC transporters for the uptake of iron/ siderophores

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG0609 (Galperin et al., 2021)

Gene

Coordinates: 181,347  182,351

Phenotypes of a mutant

severe growth inhibition upon addition of subinhibitory concentrations of mirubactin C PubMed

The protein

Protein family

Binding-protein-dependent transport system permease family (according to UniProt)
FecCD subfamily (according to UniProt)

Structure

4G1U (PDB) (heme transporter from Yersinia pestis, 33% identity) PubMed
P40410 (AlphaFold)

Paralogous protein(s)

FecD, FhuB

Localization

cell membrane PubMed

Expression and Regulation

Operons

Genes: feuA-feuB-feuC-ybbA

Description: PubMed

Regulation

expression during spore germination is strongly reduced under conditions of osmotic stress PubMed
induced by iron starvation (second wave to allow iron scavenging from the environment) (Fur) PubMed

Regulatory mechanism

Fur: repression, PubMed, in fur regulon
Btr: activation, in the presence of the co-activators bacillibactin or enterobactin PubMed, in btr regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Additional information

the presence of an iron-responsive element bound by CitB between ''feuA and feuB'' suggests iron-dependent regulation by CitB PubMed

Other regulations

CitB: translation control

Biological materials

Mutant

BKE01620 (feuB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ATACATACAAAAACCTACTC,  downstream forward: _UP4_ATTAAACGAAAAGGAGGGGA
BKK01620 (feuB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ATACATACAAAAACCTACTC,  downstream forward: _UP4_ATTAAACGAAAAGGAGGGGA

References

Loading