cwlD

168

N-acetylmuramoyl-L-alanine amidase, spore cortex peptidoglycan synthesis

Locus: BSU_01530

Molecular weight: 26.86 kDa

Isoelectric point: 9.79

Protein length: 237 aa

Gene length: 714 bp

Function: spore cortex peptidoglycan synthesis

Product: N-acetylmuramoyl-L-alanine amidase

Essential: no

E.C.: 3.5.1.28

Synonyms: cwlD

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0860 (Galperin et al., 2021)

Gene

Coordinates: 156,612 → 157,325

The protein

Catalyzed reaction/ biological activity

• formation of muramic acid delta-lacton in spore cortex peptidoglycan PubMed
• Hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in certain cell-wall glycopeptides (according to UniProt)

Protein family

• N-acetylmuramoyl-L-alanine amidase 3 family (according to UniProt)

Domains

• contains an amidase_3 domain (like CwlC, LytC, YqiI, YrvJ)
• MurNAc-LAA domain (aa 43-226) (according to UniProt)

Structure

• 7RAG (PDB) (from Clostridium difficile, complex with GerS, 40.4% identity) PubMed
• P50864 (AlphaFold)

Localization

• secreted (according to Swiss-Prot)

Expression and Regulation

Operons

• Genes: ybaK-cwlD

  Description: PubMed

  Regulation

  • expressed during sporulation (SigG) PubMed

  Regulatory mechanism

  • LexA: repression, PubMed, in lexA regulon

  Sigma factors

  • SigE: sigma factor, PubMed, in sigE regulon
  • SigG: sigma factor, PubMed, in sigG regulon

• Genes: cwlD

  Description: PubMed

  Regulation

  • expressed during sporulation (SigG, SigE) PubMed

Biological materials

Mutant

• BKE01530 (ΔcwlD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCCCTTCCCCTCCCGCTT,  downstream forward: _UP4_TAATGGAGGGTTTTCTTGTG
• BKK01530 (ΔcwlD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCCCTTCCCCTCCCGCTT,  downstream forward: _UP4_TAATGGAGGGTTTTCTTGTG

References

Tobin MJ, Cho SY, Profy W, Ryan TM, Le DH, Lin C, Yip EZ, Dorsey JL, Levy BR, Rhodes JD, Welsh MAReconstituting Spore Cortex Peptidoglycan Biosynthesis Reveals a Deacetylase That Catalyzes Transamidation.Biochemistry. 2023 Apr 18; 62(8):1342-1346. PMID: 37021938
Galperin MY, Yutin N, Wolf YI, Vera Alvarez R, Koonin EVConservation and Evolution of the Sporulation Gene Set in Diverse Members of the Firmicutes.Journal of bacteriology. 2022 May 31; :e0007922. PMID: 35638784
Alves Feliciano C, Eckenroth BE, Diaz OR, Doublié S, Shen AA lipoprotein allosterically activates the CwlD amidase during Clostridioides difficile spore formation.PLoS genetics. 2021 Sep; 17(9):e1009791. PMID: 34570752
Turner RD, Vollmer W, Foster SJ Different walls for rods and balls: the diversity of peptidoglycan. Molecular microbiology. 2014 Mar; 91(5):862-74. doi:10.1111/mmi.12513. PMID:24405365
Zhang P, Thomas S, Li YQ, Setlow P Effects of cortex peptidoglycan structure and cortex hydrolysis on the kinetics of Ca(2+)-dipicolinic acid release during Bacillus subtilis spore germination. Journal of bacteriology. 2012 Feb; 194(3):646-52. doi:10.1128/JB.06452-11. PMID:22123250
Au N, Kuester-Schoeck E, Mandava V, Bothwell LE, Canny SP, Chachu K, Colavito SA, Fuller SN, Groban ES, Hensley LA, O'Brien TC, Shah A, Tierney JT, Tomm LL, O'Gara TM, Goranov AI, Grossman AD, Lovett CM Genetic composition of the Bacillus subtilis SOS system. Journal of bacteriology. 2005 Nov; 187(22):7655-66. . PMID:16267290
Gilmore ME, Bandyopadhyay D, Dean AM, Linnstaedt SD, Popham DL Production of muramic delta-lactam in Bacillus subtilis spore peptidoglycan. Journal of bacteriology. 2004 Jan; 186(1):80-9. . PMID:14679227
Cowan AE, Koppel DE, Setlow B, Setlow P A soluble protein is immobile in dormant spores of Bacillus subtilis but is mobile in germinated spores: implications for spore dormancy. Proceedings of the National Academy of Sciences of the United States of America. 2003 Apr 01; 100(7):4209-14. . PMID:12646705
Popham DL, Meador-Parton J, Costello CE, Setlow P Spore peptidoglycan structure in a cwlD dacB double mutant of Bacillus subtilis. Journal of bacteriology. 1999 Oct; 181(19):6205-9. . PMID:10498740
Sekiguchi J, Akeo K, Yamamoto H, Khasanov FK, Alonso JC, Kuroda A Nucleotide sequence and regulation of a new putative cell wall hydrolase gene, cwlD, which affects germination in Bacillus subtilis. . Journal of bacteriology. 1995 Oct; 177(19):5582-9. . PMID:7559346