2019-12-27 10:41:132025-05-22 18:23:34
The protein
Catalyzed reaction/ biological activity
binds ssDNA, promotes displacement of [[protein|SsbA]] and [[protein|SsbB]] from ssDNA [Pubmed|23779106]
provides [[protein|RecA]] access to ssDNA during chromosomal transformation (together with [[protein|RecO]]) [Pubmed|22373918]
[[protein|RecA]]-ATP in concert with [[protein|DprA]] and [[protein|SsbA]] catalyzes DNA strand exchange, with [[protein|SsbB]] as an accessory factor [Pubmed|25138221]
binds ssDNA, promotes displacement of [[protein|SsbA]] and [[protein|SsbB]] from ssDNA [Pubmed|23779106]
provides [[protein|RecA]] access to ssDNA during chromosomal transformation (together with [[protein|RecO]]) [Pubmed|22373918]
[[protein|RecA]]-ATP in concert with [[protein|DprA]] and [[protein|SsbA]] catalyzes DNA strand exchange, with [[protein|SsbB]] as an accessory factor [Pubmed|25138221]
the [[protein|SsbA]]-[[protein|DprA]] mediator loads [[protein|RecA]] onto any fragmented linear SPP1 ssDNA [pubmed|31876108]
anneals [[protein|SsbA]]- or [[protein|SsbB]]-coated complementary strands of transfecting SPP1 phage DNA, yielding tailed SPP1 duplex intermediates [pubmed|31876108]
[[protein|DprA]], [[protein|RecO]] or viral single strand annealing G35P protein, may catalyze the annealing of complete linear phage genomes with redundant regions at the ends of the molecule, alone or with the help of an exonuclease, to produce a circular unit-length duplex viral genome ready to initiate replication [pubmed|31876108]
Biological materials
Mutant
BKE16110 (Δ[[gene|dprA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAGATTGACCTCCTTTT, downstream forward: _UP4_TGAATTATCGTTTGACAAAC
BKK16110 (Δ[[gene|dprA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAGATTGACCTCCTTTT, downstream forward: _UP4_TGAATTATCGTTTGACAAAC
BKE16110 (Δ[[gene|dprA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAGATTGACCTCCTTTT, downstream forward: _UP4_TGAATTATCGTTTGACAAAC
BKK16110 (Δ[[gene|dprA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16110 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CAATAGATTGACCTCCTTTT, downstream forward: _UP4_TGAATTATCGTTTGACAAAC
References
References
Reviews
References
Original publications