SubtiBank SubtiBank
Version comparison:

2019-12-27 10:41:132025-05-22 18:23:34

The protein

Catalyzed reaction/ biological activity

binds ssDNA, promotes displacement of [[protein|SsbA]] and [[protein|SsbB]] from ssDNA [Pubmed|23779106]

provides [[protein|RecA]] access to ssDNA during chromosomal transformation (together with [[protein|RecO]]) [Pubmed|22373918]

[[protein|RecA]]-ATP in concert with [[protein|DprA]] and [[protein|SsbA]] catalyzes DNA strand exchange, with [[protein|SsbB]] as an accessory factor [Pubmed|25138221]

binds ssDNA, promotes displacement of [[protein|SsbA]] and [[protein|SsbB]] from ssDNA [Pubmed|23779106]

provides [[protein|RecA]] access to ssDNA during chromosomal transformation (together with [[protein|RecO]]) [Pubmed|22373918]

[[protein|RecA]]-ATP in concert with [[protein|DprA]] and [[protein|SsbA]] catalyzes DNA strand exchange, with [[protein|SsbB]] as an accessory factor [Pubmed|25138221]

the [[protein|SsbA]]-[[protein|DprA]] mediator loads [[protein|RecA]] onto any fragmented linear SPP1 ssDNA [pubmed|31876108]

anneals [[protein|SsbA]]- or [[protein|SsbB]]-coated complementary strands of transfecting SPP1 phage DNA, yielding tailed SPP1 duplex intermediates [pubmed|31876108]

[[protein|DprA]], [[protein|RecO]] or viral single strand annealing G35P protein, may catalyze the annealing of complete linear phage genomes with redundant regions at the ends of the molecule, alone or with the help of an exonuclease, to produce a circular unit-length duplex viral genome ready to initiate replication [pubmed|31876108]

Biological materials

Mutant

BKE16110 (Δ[[gene|dprA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAGATTGACCTCCTTTT, downstream forward: _UP4_TGAATTATCGTTTGACAAAC

BKK16110 (Δ[[gene|dprA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAGATTGACCTCCTTTT, downstream forward: _UP4_TGAATTATCGTTTGACAAAC

BKE16110 (Δ[[gene|dprA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATAGATTGACCTCCTTTT, downstream forward: _UP4_TGAATTATCGTTTGACAAAC

BKK16110 (Δ[[gene|dprA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16110 BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CAATAGATTGACCTCCTTTT, downstream forward: _UP4_TGAATTATCGTTTGACAAAC

References

17630974, 17803906, 12421306, 18045469, 11948146, 22373918, 23779106, 23440217, 25138221, 26786319, 28618091, 22904190, 28911099, 30050509

References

Reviews

31950915

References

Original publications

17630974, 17803906, 12421306, 18045469, 11948146, 22373918, 23779106, 23440217, 25138221, 26786319, 28618091, 22904190, 28911099, 30050509, 31876108