SubtiBank SubtiBank
Version comparison:

2017-06-23 17:02:222025-05-15 23:29:46

description

transcriptional antiterminator of the bglP-bglH-yxiE operon and the bglS gene

transcriptional antiterminator of the [[gene|bglP]]-[[gene|bglH]]-[[gene|yxiE ]]operon and the [[gene|bglS ]]gene

locus

BSU39080

BSU_39080

geneLength

831

834

outlinks

bsu

BSU39080

BSU_39080

Gene

Phenotypes of a mutant

no expression of the ''[[gene|bglP]]-[[gene|bglH]]'' operon

no expression of the [[gene|bglP]]-[[gene|bglH]] operon

The protein

Protein family

BglG family of antiterminators (according to Swiss-Prot)

[SW|PRD-containing transcription factors]

The protein

Paralogous protein(s)

[[protein|SacY]], [[protein|GlcT]], [[protein|SacT]]

[[this]]

The protein

[SW|Domains]

N-terminal RNA binding domain [Pubmed|10610766]

2 x [SW|PRD] ([[protein|PtsI]] regulation domains) [Pubmed|11447120]

N-terminal RNA binding domain [Pubmed|10610766]

2 x [SW|PRD] ([SW|PTS] regulation domains) [Pubmed|11447120]

2 [SW|PRD] domains (aa 65-170, aa 171-277) (according to UniProt)

The protein

Modification

phosphorylation at His-100 in [SW|PRD]-1 by phosphorylated [[protein|BglP]], inhibits LicT antitermination activity

phosphorylation at His-207 and/or His-269 in [SW|PRD]-2 by His-P-[[gene|ptsH|HPr]]]], stimulates LicT antitermination activity

phosphorylation at His-100 in [SW|PRD]-1 by phosphorylated [[protein|BglP]], inhibits LicT antitermination activity

phosphorylation at His-207 and/or His-269 in [SW|PRD]-2 by His-P-[[gene|ptsH|HPr]], stimulates LicT antitermination activity

Biological materials

Mutant

GP427 (licTS, erm), available in [SW|Jörg Stülke]'s lab

GP427 (Δ[[gene|licT]]-[[gene|bglS]]::[[gene|erm]]), available in [SW|Jörg Stülke]'s lab

BKE39080 (Δ[[gene|licT]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCATGTCCCTCCAAAT, downstream forward: _UP4_TAATGAGAGCGCTGACATTT

BKK39080 (Δ[[gene|licT]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCATGTCCCTCCAAAT, downstream forward: _UP4_TAATGAGAGCGCTGACATTT

Biological materials

Expression vector

for expression, purification of both PRDs in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP165, available in [SW|Jörg Stülke]'s lab

for expression, purification of the RNA-binding domain in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP315, available in [SW|Jörg Stülke]'s lab

for expression, purification of the RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP572, available in [SW|Jörg Stülke]'s lab

Biological materials

GFP fusion

GP1225 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab

GP1225, [[gene|licT]]-gfp, spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab [pubmed|23475962]

GP1229, [[gene|licT]]-yfp, spc), available in [SW|Jörg Stülke]'s lab [pubmed|23475962]

Labs working on this gene/protein

[SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France

[SW|Josef Deutscher], Microbiology and Molecular Genetics, INRA Paris-Grignon, France

The protein

additional information

information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000053 PRODORIC2 database]

Biological materials

Expression vectors

for expression, purification of both PRDs in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP165, available in [SW|Jörg Stülke]'s lab

for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP315, available in [SW|Jörg Stülke]'s lab

for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP572, available in [SW|Jörg Stülke]'s lab

labs

[SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France

[SW|Josef Deutscher], Microbiology and Molecular Genetics, INRA Paris-Grignon, France