Thu Nov 03 2016 15:13:52 GMT+0100 (CET)2025-01-22 18:42:28
description
transcriptional antiterminator of the bglP-bglH-yxiE operon and the bglS gene
transcriptional antiterminator of the [[gene|bglP]]-[[gene|bglH]]-[[gene|yxiE ]]operon and the [[gene|bglS ]]gene
locus
BSU39080
BSU_39080
ec
outlinks
bsu
BSU39080
BSU_39080
[SW|Categories] containing this gene/protein
[SW|utilization of specific carbon sources], [SW|transcription factors and their control], [SW|RNA binding regulators], [SW|phosphoproteins]
Gene
Coordinates on the chromosome (coding sequence)
4,012,866 -> 4,013,699
Gene
Phenotypes of a mutant
no expression of the ''[[protein|bglP]]-[[protein|bglH]]'' operon
no expression of the [[gene|bglP]]-[[gene|bglH]] operon
The protein
Catalyzed reaction/ biological activity
binding to the mRNAs of ''[[protein|bglS]]'' and the ''[[protein|bglP]]-[[protein|bglH]]'' operon, causes transcription antitermination (in presence of salicin and absence of glucose)
binding to the mRNAs of ''[[gene|bglS]]'' and the ''[[gene|bglP]]-[[gene|bglH]]'' operon, causes transcription antitermination (in presence of salicin and absence of glucose)
The protein
Protein family
[[PRD-containing transcription factors|transcriptional antiterminator]] BglG family of antiterminators (according to Swiss-Prot)
[SW|PRD-containing transcription factors]
The protein
Paralogous protein(s)
[[protein|SacY]], [[protein|GlcT]], [[protein|SacT]]
[[this]]
The protein
[SW|Domains]
N-terminal RNA binding domain [Pubmed|10610766]
2 x [SW|PRD] ([SW|PTS] regulation domains) [Pubmed|11447120]
N-terminal RNA binding domain [Pubmed|10610766]
2 x [SW|PRD] ([SW|PTS] regulation domains) [Pubmed|11447120]
2 [SW|PRD] domains (aa 65-170, aa 171-277) (according to UniProt)
The protein
Modification
phosphorylation at His-100 in [SW|PRD]-1 by phosphorylated [[protein|BglP]], inhibits LicT antitermination activity
phosphorylation at His-207 and/or His-269 in [SW|PRD]-2 by His-P-[[ptsH|HPr]], stimulates LicT antitermination activity
phosphorylation at His-100 in [SW|PRD]-1 by phosphorylated [[protein|BglP]], inhibits LicT antitermination activity
phosphorylation at His-207 and/or His-269 in [SW|PRD]-2 by His-P-[[gene|ptsH|HPr]], stimulates LicT antitermination activity
The protein
[SW|Interactions]
[[protein|PtsH]]-[[protein|LicT]], [[protein|BglP]]-[[protein|LicT]]
Expression and Regulation
Operon
''[[protein|licT]]-[[protein|bglS]]'' [Pubmed|8606172]
Expression and Regulation
[SW|Sigma factor]
[[protein|SigA]] [Pubmed|8606172]
Biological materials
Mutant
GP427 (licTS, erm), available in [SW|Jörg Stülke]'s lab
GP427 (Δ[[gene|licT]]-[[gene|bglS]]::[[gene|erm]]), available in [SW|Jörg Stülke]'s lab
BKE39080 (Δ[[gene|licT]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCATGTCCCTCCAAAT, downstream forward: _UP4_TAATGAGAGCGCTGACATTT
BKK39080 (Δ[[gene|licT]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCATGTCCCTCCAAAT, downstream forward: _UP4_TAATGAGAGCGCTGACATTT
Biological materials
Expression vector
for expression, purification of both PRDs in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP165, available in [SW|Jörg Stülke]'s lab
for expression, purification of the RNA-binding domain in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP315, available in [SW|Jörg Stülke]'s lab
for expression, purification of the RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP572, available in [SW|Jörg Stülke]'s lab
Biological materials
GFP fusion
GP1225 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab
GP1225, [[gene|licT]]-gfp, spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab [pubmed|23475962]
GP1229, [[gene|licT]]-yfp, spc), available in [SW|Jörg Stülke]'s lab [pubmed|23475962]
Labs working on this gene/protein
[SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
[SW|Josef Deutscher], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
[SW|Michael Hecker], Greifswald, Germany [http://www.mikrobiologie.uni-greifswald.de/index.php?id=20 Homepage]
References
Original publications
proteinLength
277
geneLength
834
Gene
Coordinates
4,012,866 → 4,013,699
The protein
additional information
information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000053 PRODORIC2 database]
Expression and Regulation
Operons
[[this]]
Expression and Regulation
Other regulations
[[this]]
Biological materials
Expression vectors
for expression, purification of both PRDs in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP165, available in [SW|Jörg Stülke]'s lab
for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP315, available in [SW|Jörg Stülke]'s lab
for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP572, available in [SW|Jörg Stülke]'s lab
labs
[SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
[SW|Josef Deutscher], Microbiology and Molecular Genetics, INRA Paris-Grignon, France