SubtiBank SubtiBank
Version comparison:

Thu Nov 03 2016 15:13:52 GMT+0100 (CET)2025-01-22 18:42:28

description

transcriptional antiterminator of the bglP-bglH-yxiE operon and the bglS gene

transcriptional antiterminator of the [[gene|bglP]]-[[gene|bglH]]-[[gene|yxiE ]]operon and the [[gene|bglS ]]gene

locus

BSU39080

BSU_39080

ec

outlinks

bsu

BSU39080

BSU_39080

[SW|Categories] containing this gene/protein

[SW|utilization of specific carbon sources], [SW|transcription factors and their control], [SW|RNA binding regulators], [SW|phosphoproteins]

Gene

Coordinates on the chromosome (coding sequence)

4,012,866 -> 4,013,699

Gene

Phenotypes of a mutant

no expression of the ''[[protein|bglP]]-[[protein|bglH]]'' operon

no expression of the [[gene|bglP]]-[[gene|bglH]] operon

The protein

Catalyzed reaction/ biological activity

binding to the mRNAs of ''[[protein|bglS]]'' and the ''[[protein|bglP]]-[[protein|bglH]]'' operon, causes transcription antitermination (in presence of salicin and absence of glucose)

binding to the mRNAs of ''[[gene|bglS]]'' and the ''[[gene|bglP]]-[[gene|bglH]]'' operon, causes transcription antitermination (in presence of salicin and absence of glucose)

The protein

Protein family

[[PRD-containing transcription factors|transcriptional antiterminator]] BglG family of antiterminators (according to Swiss-Prot)

[SW|PRD-containing transcription factors]

The protein

Paralogous protein(s)

[[protein|SacY]], [[protein|GlcT]], [[protein|SacT]]

[[this]]

The protein

[SW|Domains]

N-terminal RNA binding domain [Pubmed|10610766]

2 x [SW|PRD] ([SW|PTS] regulation domains) [Pubmed|11447120]

N-terminal RNA binding domain [Pubmed|10610766]

2 x [SW|PRD] ([SW|PTS] regulation domains) [Pubmed|11447120]

2 [SW|PRD] domains (aa 65-170, aa 171-277) (according to UniProt)

The protein

Modification

phosphorylation at His-100 in [SW|PRD]-1 by phosphorylated [[protein|BglP]], inhibits LicT antitermination activity

phosphorylation at His-207 and/or His-269 in [SW|PRD]-2 by His-P-[[ptsH|HPr]], stimulates LicT antitermination activity

phosphorylation at His-100 in [SW|PRD]-1 by phosphorylated [[protein|BglP]], inhibits LicT antitermination activity

phosphorylation at His-207 and/or His-269 in [SW|PRD]-2 by His-P-[[gene|ptsH|HPr]], stimulates LicT antitermination activity

The protein

[SW|Interactions]

[[protein|PtsH]]-[[protein|LicT]], [[protein|BglP]]-[[protein|LicT]]

Expression and Regulation

Operon

''[[protein|licT]]-[[protein|bglS]]'' [Pubmed|8606172]

Expression and Regulation

[SW|Sigma factor]

[[protein|SigA]] [Pubmed|8606172]

Biological materials

Mutant

GP427 (licTS, erm), available in [SW|Jörg Stülke]'s lab

GP427 (Δ[[gene|licT]]-[[gene|bglS]]::[[gene|erm]]), available in [SW|Jörg Stülke]'s lab

BKE39080 (Δ[[gene|licT]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCATGTCCCTCCAAAT, downstream forward: _UP4_TAATGAGAGCGCTGACATTT

BKK39080 (Δ[[gene|licT]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCATGTCCCTCCAAAT, downstream forward: _UP4_TAATGAGAGCGCTGACATTT

Biological materials

Expression vector

for expression, purification of both PRDs in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP165, available in [SW|Jörg Stülke]'s lab

for expression, purification of the RNA-binding domain in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP315, available in [SW|Jörg Stülke]'s lab

for expression, purification of the RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP572, available in [SW|Jörg Stülke]'s lab

Biological materials

GFP fusion

GP1225 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab

GP1225, [[gene|licT]]-gfp, spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s lab [pubmed|23475962]

GP1229, [[gene|licT]]-yfp, spc), available in [SW|Jörg Stülke]'s lab [pubmed|23475962]

Labs working on this gene/protein

[SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France

[SW|Josef Deutscher], Microbiology and Molecular Genetics, INRA Paris-Grignon, France

[SW|Michael Hecker], Greifswald, Germany [http://www.mikrobiologie.uni-greifswald.de/index.php?id=20 Homepage]

References

Original publications

8606172, 23475962, 11447120, 10610766, 7559347, 8626332, 10048041, 11447120, 11580842, 11733988, 12169607, 12398354, 15699035, 17074746, 21278164, 21335451

8606172, 23475962, 11447120, 10610766, 7559347, 8626332, 10048041, 11447120, 11580842, 11733988, 12169607, 12398354, 15699035, 17074746, 21278164, 21335451, 28235843

proteinLength

277

geneLength

834

Gene

Coordinates

4,012,866 → 4,013,699

The protein

additional information

information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000053 PRODORIC2 database]

Expression and Regulation

Operons

[[this]]

Expression and Regulation

Other regulations

[[this]]

Biological materials

Expression vectors

for expression, purification of both PRDs in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP165, available in [SW|Jörg Stülke]'s lab

for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP315, available in [SW|Jörg Stülke]'s lab

for expression, purification of RNA-binding domain in ''E. coli'' with N-terminal His-tag and thrombin cleavage site, in [SW|pGP570]: pGP572, available in [SW|Jörg Stülke]'s lab

labs

[SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France

[SW|Josef Deutscher], Microbiology and Molecular Genetics, INRA Paris-Grignon, France