BSU04580

BSU_04580

BSU04580

BSU_04580

[SW|DEAD-box RNA helicases], [SW|translation], [SW|cold stress proteins], [SW|membrane proteins]

511,106 -> 512,641

poor growth at low temperatures (16 to 20°C) [Pubmed|23175651]

reduced number of [SW|ribosome]s [Pubmed|23175651]

no expression of the ''[[protein|frlB]]-[[protein|frlO]]-[[protein|frlN]]-[[protein|frlM]]-[[protein|frlD]]'' operon [Pubmed|23175651]

strongly increased expression of the ''[[protein|ysbA]]-[[protein|ysbB]]'' operon [Pubmed|23175651]

transcription profile resulting from ''[[protein|rny]]'' depletion: [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE36877 GEO] [Pubmed|23175651]

poor growth at low temperatures (16 to 20°C) [Pubmed|23175651]

reduced number of [SW|ribosome]s [Pubmed|23175651]

no expression of the ''[[gene|frlB]]-[[gene|frlO]]-[[gene|frlN]]-[[gene|frlM]]-[[gene|frlD]]'' operon [Pubmed|23175651]

strongly increased expression of the ''[[gene|pftA]]-[[gene|pftB]]'' operon [Pubmed|23175651]

transcription profile resulting from ''[[gene|rny]]'' depletion: [http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE36877 GEO] [Pubmed|23175651]

RNA helicase

required for [SW|ribosome] assembly (biogenesis of the large subunit) [Pubmed|23175651]

RNA helicase

required for [SW|ribosome] assembly (biogenesis of the large subunit) [Pubmed|23175651]

unwind duplex RNA with or without overhangs [pubmed|28238534]

ATP + H₂O --> ADP + H⁺ + phosphate (according to UniProt)

helicase C-terminal domain (according to Swiss-Prot) [SW|DEAD-box RNA helicases]

[SW|helicase family] (according to UniProt)

[SW|DEAD-box RNA helicases] (according to UniProt)

[[protein|CshB]], [[protein|DeaD]], [[protein|YfmL]]

[[this]]

cytoplasma, colocalizes with the ribosomes [Pubmed|16352840,27708634], cell membrane [Pubmed|20572937]

cytoplasma, colocalizes with the ribosomes [Pubmed|16352840,27708634], may also associate with the cell membrane [Pubmed|20572937]

CshA interacts with the [SW|RNA polymerase] [Pubmed|21710567]

part of the [SW|RNA degradosome] [Pubmed|20572937]

[[protein|CshA]]-[[protein|CshA]] [Pubmed|20572937]

[[protein|CshA]]-[[protein|CspB]] [Pubmed|16352840]

[[protein|CshA]]-[[protein|PnpA]] [Pubmed|20572937]

[[protein|CshA]]-[[protein|Rny]] [Pubmed|20572937,21803996]

[[protein|CshA]]-[[protein|RnjA]] [Pubmed|20572937]

[[protein|CshA]]-[[protein|Eno]] [Pubmed|20572937]

[[protein|CshA]]-[[protein|PfkA]] [Pubmed|20572937]

[[protein|DeaD]]-[[protein|CshA]] [Pubmed|20572937]

[[protein|RnpA]]-[[protein|CshA]] [Pubmed|21764917]

[[protein|RplA]]-[[protein|CshA]] [Pubmed|23175651]

[[protein|RplC]]-[[protein|CshA]] [Pubmed|23175651]

induced by cold shock [Pubmed|12399512]

constitutive, similar expression at high and low temperatures, throughout growth and in both minimal and complex medium [Pubmed|20572937]

GP1035 (aphA3), available in [SW|Jörg Stülke]'s lab

GP1083 (cat), available in [SW|Jörg Stülke]'s lab

GP1035 (Δ[[gene|cshA]]::aphA3), available in [SW|Jörg Stülke]'s lab [pubmed|23175651]

GP1083 (Δ[[gene|cshA]]::cat), available in [SW|Jörg Stülke]'s lab

BKE04580 (Δ[[gene|cshA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTATAAAACTGCCCTTT, downstream forward: _UP4_TAATTTGATCGATTCAGAGC

BKK04580 (Δ[[gene|cshA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTATAAAACTGCCCTTT, downstream forward: _UP4_TAATTTGATCGATTCAGAGC

for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], in [SW|pGP382]: pGP1387, available in [SW|Jörg Stülke]'s lab

for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], expression from the native chromomsomal site: GP1026 (aphA3), available in [SW|Jörg Stülke]'s lab

for expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP1386, available in [SW|Jörg Stülke]'s lab

pGP1369 for chromosomal expression of CshA-YFP, available in [SW|Jörg Stülke]'s lab

''B. subtilis'' GP1081 cshA-gfp spc, available in [SW|Jörg Stülke]'s lab,

pGP1369 for chromosomal expression of CshA-YFP, available in [SW|Jörg Stülke]'s lab

''B. subtilis'' GP1081 cshA-gfp spc, available in [SW|Jörg Stülke]'s lab,

GP1721 (in [SW|pBP43]), expression of '' cshA-GFP''::''spc'' under the native promoter, available in [SW|Jörg Stülke]'s lab [Pubmed|27708634]

B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab

B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|20572937]

[SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]

20572937, 23175651, 21803996, 16352840, 27708634, 27965645

511

1536

511,106 → 512,641

[SW|Helicase ATP-binding domain] (aa 34-204) (according to UniProt)

[SW|Helicase C-terminal domain] (aa 215-375) (according to UniProt)

[PDB|5IVL] [Pubmed|28238534]

[[this]]

[[this]]

for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], in [SW|pGP382]: pGP1387, available in [SW|Jörg Stülke]'s lab

for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], expression from the native chromomsomal site: GP1026 (aphA3), available in [SW|Jörg Stülke]'s lab

for expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP1386, available in [SW|Jörg Stülke]'s lab

[SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]

22568516, 29314657, 19747077, 25907111

20572937, 23175651, 21803996, 16352840, 27708634, 27965645, 28238534, 30337909