locus

BSU34540

BSU_34540

geneLength

591

594

outlinks

bsu

BSU34540

BSU_34540

The protein

Catalyzed reaction/ biological activity

Hydrolysis of proteins to small peptides in the presence of ATP and magnesium (according to Swiss-Prot) endopeptidase/proteolysis

Hydrolysis of proteins to small peptides in the presence of ATP and magnesium. Alpha-casein is the usual test substrate. In the absence of ATP, only oligopeptides shorter than five residues are hydrolyzed (such as succinyl-Leu-Tyr-|-NHMec, and Leu-Tyr-Leu-|-Tyr-Trp, in which cleavage of the -Tyr-|-Leu- and -Tyr-|-Trp bonds also occurs) (according to UniProt)

antibiotic-activated [[protein|ClpP]] unfolds [[protein|FtsZ]] for N-terminal degradation [pubmed|32605984]

The protein

Protein family

peptidase S14 family (according to Swiss-Prot) ClpP (IPR001907) [http://www.ebi.ac.uk/interpro/DisplayIproEntry?ac=IPR001907 InterPro], (PF00574) [http://pfam.sanger.ac.uk/family?acc=PF00574 PFAM]

Peptidase S14 family (with [[protein|TepA]], according to UniProt)

Biological materials

Mutant

''clpP::spec'' and ''clpP::cat'', available in the [SW|Leendert Hamoen] lab

BP99 (''clpP''::''tet''), available in [SW|Fabian Commichau]'s lab [Pubmed|25610436]

GP551 (spc), available in [SW|Jörg Stülke]'s lab

QB4916 (spc), available in [SW|Ulf Gerths]'s and [SW|Jörg Stülke]'s labs

1S139 (''clpP''::''erm''), available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S139&Search=1S139 BGSC]

1S140 ( ''clpP''::''spec''), available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S140&Search=1S140 BGSC]

BKE34540 (''[[gene|clpP]]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab)

GP1822 and GP1786 (''[[gene|clpP]]''::''erm'', available in [SW|Jörg Stülke]'s lab)

GPUG1 (erm), available in [SW|Ulf Gerth]'s and [SW|Jörg Stülke]'s labs

''clpP::spec'' and ''clpP::cat'', available in the [SW|Leendert Hamoen] lab

BP99 (''clpP''::''tet''), available in [SW|Fabian Commichau]'s lab [Pubmed|25610436]

GP551 (spc), available in [SW|Jörg Stülke]'s lab

QB4916 (spc), available in [SW|Ulf Gerths]'s and [SW|Jörg Stülke]'s labs

1S139 (''clpP''::''erm''), available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S139&Search=1S139 BGSC]

1S140 ( ''clpP''::''spec''), available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1S140&Search=1S140 BGSC]

BKE34540 (''[[gene|clpP]]''::''erm'', available in the BGSC and in [SW|Jörg Stülke]'s lab) [pubmed|28189581]

GP1822 and GP1786 (''[[gene|clpP]]''::''erm'', available in [SW|Jörg Stülke]'s lab)

GPUG1 (erm), available in [SW|Ulf Gerth]'s and [SW|Jörg Stülke]'s labs

BKE34540 (Δ[[gene|clpP]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGCTCCTCCTTCACC, downstream forward: _UP4_TAATAACACAACCTGCAAGA

BKK34540 (Δ[[gene|clpP]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGCTCCTCCTTCACC, downstream forward: _UP4_TAATAACACAACCTGCAAGA

Labs working on this gene/protein

[SW|Leendert Hamoen], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/l.hamoen homepage]

References

Reviews

16211032, 17302811, 23375660, 23479438, 19609260, 19781636, 26639779

16211032, 17302811, 23375660, 23479438, 19609260, 19781636, 26639779, 28748186

References

Original Publications

9643546, 10809708, 11807061, 9987115, 14679237, 18689476, 15317791, 17586624, 11684022, 12923101, 17560370, 16899079, 19226326, 20070525, 9987115, 11544224, 14763982, 9643546, 19767395, 11112444, 9535081, 18689473, 20305655, 20852588, 16200071, 21969594, 22080375, 22517742, 17380125, 12598648, 9890793, 20049702, 20049702, 23927726, 24263382, 24226776, 24417481, 15378759, 23361916, 24942655, 25212124, 25433860, 25610436, 26387458, 27014237, 27669037

9643546, 10809708, 11807061, 9987115, 14679237, 18689476, 15317791, 17586624, 11684022, 12923101, 17560370, 16899079, 19226326, 20070525, 9987115, 11544224, 14763982, 9643546, 19767395, 11112444, 9535081, 18689473, 20305655, 20852588, 16200071, 21969594, 22080375, 22517742, 17380125, 12598648, 9890793, 20049702, 20049702, 23927726, 24263382, 24226776, 24417481, 15378759, 23361916, 24942655, 25212124, 25433860, 25610436, 26387458, 27014237, 27669037, 28760849, 29186773, 29625553, 28333276, 31362989, 32181548, 32442436, 32477307, 32605984

The protein

Paralogous protein(s)

[[this]]

labs

[SW|Leendert Hamoen], Newcastle University, UK [http://www.ncl.ac.uk/camb/staff/profile/l.hamoen homepage]