2018-02-10T12:32:26.000Z2025-03-14 11:38:10

locus

BSU22960

BSU_22960

proteinLength

426

427

geneLength

1278

1284

outlinks

bsu

BSU22960

BSU_22960

The protein

Catalyzed reaction/ biological activity

L-glutamate + H₂O + NAD⁺ = 2-oxoglutarate + NH₃ + NADH + H⁺ (according to Swiss-Prot)

H₂O + L-glutamate + NAD⁺ --> 2-oxoglutarate + H⁺ + NADH + NH₄⁺ (according to UniProt)

The protein

Protein family

Glu/Leu/Phe/Val dehydrogenases family (according to Swiss-Prot)

Glu/Leu/Phe/Val dehydrogenases family (with [[protein|Bcd]] and [[protein|RocG]], according to UniProt)

The protein

Paralogous protein(s)

[[protein|RocG]]

[[this]]

Biological materials

Mutant

MGNA-A397 (ypcA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/397 NBRP B. subtilis, Japan]

GP691 (''ΔgudB::cat''), GP1160 (''ΔgudB::aphA3'') both available in [SW|Jörg Stülke]'s lab

BKE22960 (Δ[[gene|gudB]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAGTTAACCTCCTAG, downstream forward: _UP4_TAAGTTGATGATTTGCATAA

BKK22960 (Δ[[gene|gudB]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAGTTAACCTCCTAG, downstream forward: _UP4_TAAGTTGATGATTTGCATAA

MGNA-A397 (ypcA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/397 NBRP B. subtilis, Japan]

GP691 (''ΔgudB::cat''), GP1160 (''ΔgudB::aphA3'') both available in [SW|Jörg Stülke]'s lab

GP2834 (''gudB⁺⁺''), available in [SW|Jörg Stülke]'s lab

Biological materials

Expression vector

for purification of GudB from ''E. coli'' carrying an N-terminal Strep-tag: pGP863 (in [SW|pGP172]) available in [SW|Jörg Stülke]'s lab

for purification of GudB1 from ''E. coli'' carrying an N-terminal Strep-tag: pGP864 (in [SW|pGP172]) available in [SW|Jörg Stülke]'s lab

for ectopic expression of ''gudB'' with its native promoter: pGP900 (in [[protein|pAC5]]), available in [SW|Jörg Stülke]'s lab

wild type ''gudB'', expression in ''B. subtilis'', in [SW|pBQ200]: pGP1712, available in [SW|Jörg Stülke]'s lab

pBP179 (N-terminal Strep-tag ''gudB+'', purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Fabian Commichau]'s lab

Biological materials

lacZ fusion

pGP651 (in [[protein|pAC5]]), available in [SW|Jörg Stülke]'s lab

pGP651 (in [SW|pAC5]), available in [SW|Jörg Stülke]'s lab

Labs working on this gene/protein

[SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]

[SW|Fabian Commichau] University of Göttingen, Germany [http://genmibio.uni-goettingen.de/index.php?id=130 Homepage]

References

Original publications

18603778, 9829940, 17183217, 18723616, 18326565, 20630473, 17981983, 21219666, 22178973, 22517742, 23338837, 22178969, 23785476, 24263382, 24473333, 25610436, 25711804, 28468957, 28516784

18603778, 9829940, 17183217, 18723616, 18326565, 20630473, 17981983, 21219666, 22178973, 22517742, 23338837, 22178969, 23785476, 24263382, 24473333, 25610436, 25711804, 28468957, 28516784, 30936490, 31649652

Biological materials

Expression vectors

for purification of GudB from ''E. coli'' carrying an N-terminal Strep-tag: pGP863 (in [SW|pGP172]) available in [SW|Jörg Stülke]'s lab

for purification of GudB1 from ''E. coli'' carrying an N-terminal Strep-tag: pGP864 (in [SW|pGP172]) available in [SW|Jörg Stülke]'s lab

for ectopic expression of ''gudB'' with its native promoter: pGP900 (in [[protein|pAC5]]), available in [SW|Jörg Stülke]'s lab

wild type ''gudB'', expression in ''B. subtilis'', in [SW|pBQ200]: pGP1712, available in [SW|Jörg Stülke]'s lab

pBP179 (N-terminal Strep-tag ''gudB+'', purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Fabian Commichau]'s lab

labs

[SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]

[SW|Fabian Commichau], Senftenberg, Germany [http://www.uni-goettingen.de/de/413008.html homepage]