2017-05-09 15:36:362025-05-28 20:07:42
locus
BSU01750
BSU_01750
geneLength
819
822
outlinks
bsu
BSU01750
BSU_01750
Gene
Phenotypes of a mutant
inactivation of ''[[gene|cdaA]]'' results in severe beta-lactam sensitivity [Pubmed|22211522]
inactivation of ''[[gene|cdaA]]'' results in severe beta-lactam sensitivity [Pubmed|22211522]
a [[gene|cdaA]] [[gene|disA]] double mutant or [[gene|cdaA]] [[gene|cdaS]] [[gene|disA]] triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) [pubmed|28420751]
The protein
Catalyzed reaction/ biological activity
synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352]
synthesis of c-di-AMP from two molecules of ATP [Pubmed|23192352]
2 ATP --> c-di-AMP + 2 diphosphate (according to UniProt)
The protein
Paralogous protein(s)
[[protein|CdaS]]
[[this]]
The protein
[SW|Domains]
contains a [SW|DAC domain] involved in the synthesis of c-di-AMP [Pubmed|21566650]
contains a [SW|DAC domain] involved in the synthesis of c-di-AMP [Pubmed|21566650]
[SW|DAC domain] (aa 82-242) (according to UniProt)
The protein
Effectors of protein activity
the interaction with [[protein|CdaR]] stimulates the diadenylate cyclase activity of [[protein|CdaA]] [Pubmed|23192352]
the interaction with [[protein|CdaR]] controls the diadenylate cyclase activity of [[protein|CdaA]] [Pubmed|23192352]
the interaction with [[protein|CdaR]] inhibits the diadenylate cyclase activity of [[protein|CdaA]] (shown in S. aureus) [pubmed|30668586]
the interaction with [[protein|GlmM]] inhibits the diadenylate cyclase activity of [[protein|CdaA]] under conditions of osmotic stress (shown in L. monocytogenes) [pubmed|32250026]
The protein
Structure
[PDB|4RV7] (the [SW|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273), 65% identity) [Pubmed|25605729]
[PDB|6HUW]
[PDB|4RV7] (the [SW|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273), 65% identity) [Pubmed|25605729]
[PDB|6HVL] (the [SW|DAC domain] and C-terminal domain of CdaA from ''Listeria monocytogenes'' (aa 101 - 273) in complex with c-di-AMP, 65% identity) [Pubmed|31118276]
Biological materials
Mutant
GP94 (D''[[gene|cdaA]]''::''spc''), available in [SW|Jörg Stülke]'s lab
GP997 (''[[gene|cdaA]]''::''cat''), available in [SW|Jörg Stülke]'s lab
GP985 (''[[gene|cdaA]]''-''[[gene|cdaR]]''::''cat''), available in [SW|Jörg Stülke]'s lab
GP94 Δ[[gene|cdaA]]::spec, available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
GP997 Δ[[gene|cdaA]]::cat, available in [SW|Jörg Stülke]'s lab [pubmed|23192352]
GP2790 Δ[[gene|cdaA]]::aphA3, available in [SW|Jörg Stülke]'s lab
GP985 (''[[gene|cdaA]]''-''[[gene|cdaR]]''::''cat''), available in [SW|Jörg Stülke]'s lab
GP2222 ([[gene|cdaA]]::cat [[gene|cdaS]]::ermC ''[[gene|disA]]''::''tet''), available in [SW|Jörg Stülke]'s lab, the mutant is only viable on minimal medium at low potassium concentration [pubmed|28420751]
BKE01750 (Δ[[gene|cdaA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
BKK01750 (Δ[[gene|cdaA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
Biological materials
Expression vector
expression of native ''cdaA'' in ''B. subtilis'': pGP1960 (in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
expression of ''cdaA''-Strep in ''B. subtilis'' suitable for [SW|SPINE]: pGP1986 (in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab
IPTG inducible expression of ''cdaA''-Strep in ''E. coli'': pGP2564 (in [SW|pGP574]), available in [SW|Jörg Stülke]'s lab
Biological materials
lacZ fusion
GP1339 (cat) based on [[protein|pAC6]], available in [SW|Jörg Stülke]'s lab
GP1339 (cat) based on [SW|pAC6], available in [SW|Jörg Stülke]'s lab
Biological materials
FLAG-tag construct
GP1381 ''cdaA-3xFLAG ermC'' (based on [SW|pGP1087]), available in [SW|Jörg Stülke]'s lab
GP1381 ''cdaA-3xFLAG ermC'' (based on [SW|pGP1087]), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
References
Reviews
References
Original publications
The protein
Protein family
adenylate cyclase family (with [[protein|CdaS]], according to UniProt)
The protein
[SW|Cofactors]
Mn2+ [pubmed|31118276,25605729]
Expression and Regulation
additional information
CdaA levels are increased at increased potassium concentrations [pubmed|28420751]
the mRNA is very stable (> 15 min) [pubmed|12884008]
Biological materials
Expression vectors
expression of native ''cdaA'' in ''B. subtilis'': pGP1960 (in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
expression of ''cdaA''-Strep in ''B. subtilis'' suitable for [SW|SPINE]: pGP1986 (in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab
IPTG inducible expression of ''cdaA''-Strep in ''E. coli'': pGP2564 (in [SW|pGP574]), available in [SW|Jörg Stülke]'s lab
labs
[SW|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]