transcription-repair coupling factor, eliminates genetic damage from transcriptionally active genes during sporulation, required for increased mutagenesis of lagging strand genes

[SW|transcription]-repair coupling factor, eliminates genetic damage from transcriptionally active genes during sporulation, required for increased mutagenesis of lagging strand genes

BSU00550

BSU_00550

3531

3534

transcription-repair coupling factor

[SW|transcription]-repair coupling factor

BSU00550

BSU_00550

60,430 → 63,963

60,430 63,963

in an ''mfd'' knock-out, the cell's ability to accumulate adaptive mutations in stationary phase is depressed [http://www.pubmed.com/16950921 PubMed]

strongly reduced stationary phase mutagenesis [Pubmed|27399782]

increased UV-induced mutagenesis via [[protein|PolY1]]/ [[protein|PolY2]]-mediated translesion synthesis [Pubmed|24118570]

the mutation suppresses the mucoid phenotype of ''[[gene|motA]]'' or ''[[gene|motB]]'' mutants [Pubmed|24296669]

in an ''mfd'' knock-out, the cell's ability to accumulate adaptive mutations in stationary phase is depressed [http://www.pubmed.com/16950921 PubMed]

strongly reduced stationary phase mutagenesis [Pubmed|27399782]

increased UV-induced mutagenesis via [[protein|PolY1]]/ [[protein|PolY2]]-mediated translesion synthesis [Pubmed|24118570]

the mutation suppresses the mucoid phenotype of ''[[gene|motA]]'' or ''[[gene|motB]]'' mutants [Pubmed|24296669]

sensitive to blue light-induced DNA damage [pubmed|30054368]

sensitive to oxidative stress [pubmed|30691388]

suppression of lethality of [[gene|pcrA]] inactivation [pubmed|32793628]

promotes strand-specific DNA repair by displacing [SW|RNA polymerase] stalled at a nucleotide lesion and directing the (A)BC excinuclease to the RNA damage site

is required for roadblock transcription repression by transcription factors with binding sites downstream of the promoter (as for [[protein|CcpA]] [Pubmed|9535092] and [[protein|CodY]] [Pubmed|21699902])

required for the processing of genetic damage during [SW|sporulation] [Pubmed|24118570]

promotes strand-specific DNA repair by displacing [SW|RNA polymerase] stalled at a nucleotide lesion and directing the (A)BC excinuclease to RNA damage site

is required for roadblock transcription repression by transcription factors with binding sites downstream of the promoter (as for [[protein|CcpA]] [Pubmed|9535092] and [[protein|CodY]] [Pubmed|21699902])

required for the processing of genetic damage during [SW|sporulation] [Pubmed|24118570]

required for repair of DNA lesions during growth [pubmed|32041798]

promotes error-prone DNA repair during stress to promote genetic diversity [pubmed|32041798]

GP1167 (del ermC), available in [SW|Jörg Stülke]'s lab [Pubmed|22178973]

BKE00550 (''[[gene|mfd]]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]

BKE00550 (Δ[[gene|mfd]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGCCCCTCCTCTCTG, downstream forward: _UP4_TAAATTTTGTTACTCTCTGG

BKK00550 (Δ[[gene|mfd]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGCCCCTCCTCTCTG, downstream forward: _UP4_TAAATTTTGTTACTCTCTGG

GP3519 (Δ[[gene|mfd]]::kan), available in [SW|Jörg Stülke]'s lab

GP1167 (del ermC), available in [SW|Jörg Stülke]'s lab [Pubmed|22178973]

BKE00550 (''[[gene|mfd]]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]

BKE00550 ([[gene|mfd]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGCCCCTCCTCTCTG, downstream forward: _UP4_TAAATTTTGTTACTCTCTGG

BKK00550 ([[gene|mfd]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGCCCCTCCTCTCTG, downstream forward: _UP4_TAAATTTTGTTACTCTCTGG

17239578, 15063847, 17917874, 8811173, 7968917, 15720542, 16464004, 19023283, 22201950, 22749141, 22933559, 26132790

17239578, 15063847, 17917874, 8811173, 7968917, 15720542, 16464004, 19023283, 22201950, 22749141, 22933559, 26132790, 29856930

8594198, 20435731, 104170, 16950921, 9535092, 16469698, 21699902, 22178973, 22248542, 22960746, 21710567, 20702425, 24296669, 21145481, 24118570, 25326311, 25961799, 25713353, 27399782, 28700593, 29536659

8594198, 20435731, 104170, 16950921, 9535092, 16469698, 21699902, 22178973, 22248542, 22960746, 21710567, 20702425, 24296669, 21145481, 24118570, 25326311, 25961799, 25713353, 27399782, 28700593, 29536659, 30054368, 30691388, 32041798, 32793628, 33068413

N-terminal part: UvrB family (with [[protein|UvrB]], according to UniProt)

C-terminal part: [SW|helicase family] (according to UniProt)

[SW|Helicase ATP-binding domain] (aa 638-799) (according to UniProt)

[SW|Helicase C-terminal domain] (aa 820-974) (according to UniProt)

cytoplasm (according to UniProt)