2019-04-15 18:50:272025-05-25 00:57:54
locus
BSU00550
BSU_00550
outlinks
bsu
BSU00550
BSU_00550
Gene
Phenotypes of a mutant
in an ''mfd'' knock-out, the cell's ability to accumulate adaptive mutations in stationary phase is depressed [http://www.pubmed.com/16950921 PubMed]
strongly reduced stationary phase mutagenesis [Pubmed|27399782]
increased UV-induced mutagenesis via [[protein|PolY1]]/ [[protein|PolY2]]-mediated translesion synthesis [Pubmed|24118570]
the mutation suppresses the mucoid phenotype of ''[[gene|motA]]'' or ''[[gene|motB]]'' mutants [Pubmed|24296669]
sensitive to blue light-induced DNA damage [pubmed|30054368]
sensitive to oxidative stress [pubmed|30691388]
in an ''mfd'' knock-out, the cell's ability to accumulate adaptive mutations in stationary phase is depressed [http://www.pubmed.com/16950921 PubMed]
strongly reduced stationary phase mutagenesis [Pubmed|27399782]
increased UV-induced mutagenesis via [[protein|PolY1]]/ [[protein|PolY2]]-mediated translesion synthesis [Pubmed|24118570]
the mutation suppresses the mucoid phenotype of ''[[gene|motA]]'' or ''[[gene|motB]]'' mutants [Pubmed|24296669]
sensitive to blue light-induced DNA damage [pubmed|30054368]
sensitive to oxidative stress [pubmed|30691388]
suppression of lethality of [[gene|pcrA]] inactivation [pubmed|32793628]
The protein
Catalyzed reaction/ biological activity
promotes strand-specific DNA repair by displacing [SW|RNA polymerase] stalled at a nucleotide lesion and directing the (A)BC excinuclease to RNA damage site
is required for roadblock transcription repression by transcription factors with binding sites downstream of the promoter (as for [[protein|CcpA]] [Pubmed|9535092] and [[protein|CodY]] [Pubmed|21699902])
required for the processing of genetic damage during [SW|sporulation] [Pubmed|24118570]
promotes strand-specific DNA repair by displacing [SW|RNA polymerase] stalled at a nucleotide lesion and directing the (A)BC excinuclease to RNA damage site
is required for roadblock transcription repression by transcription factors with binding sites downstream of the promoter (as for [[protein|CcpA]] [Pubmed|9535092] and [[protein|CodY]] [Pubmed|21699902])
required for the processing of genetic damage during [SW|sporulation] [Pubmed|24118570]
required for repair of DNA lesions during growth [pubmed|32041798]
promotes error-prone DNA repair during stress to promote genetic diversity [pubmed|32041798]
The protein
Protein family
N-terminal part: UvrB family (with [[protein|UvrB]], according to UniProt)
N-terminal part: [SW|helicase family] (according to UniProt)
N-terminal part: UvrB family (with [[protein|UvrB]], according to UniProt)
C-terminal part: [SW|helicase family] (according to UniProt)
Biological materials
Mutant
GP1167 (del ermC), available in [SW|Jörg Stülke]'s lab [Pubmed|22178973]
BKE00550 (''[[gene|mfd]]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]
BKE00550 ([[gene|mfd]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGCCCCTCCTCTCTG, downstream forward: _UP4_TAAATTTTGTTACTCTCTGG
BKK00550 ([[gene|mfd]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGCCCCTCCTCTCTG, downstream forward: _UP4_TAAATTTTGTTACTCTCTGG
GP3519 (Δ[[gene|mfd]]::kan), available in [SW|Jörg Stülke]'s lab
GP1167 (del ermC), available in [SW|Jörg Stülke]'s lab [Pubmed|22178973]
BKE00550 (''[[gene|mfd]]''::''erm'', available in the BGSC, in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]
BKE00550 ([[gene|mfd]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGCCCCTCCTCTCTG, downstream forward: _UP4_TAAATTTTGTTACTCTCTGG
BKK00550 ([[gene|mfd]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGGCCCCTCCTCTCTG, downstream forward: _UP4_TAAATTTTGTTACTCTCTGG
References
Original publications
The protein
[SW|Domains]
[SW|Helicase ATP-binding domain] (aa 638-799) (according to UniProt)
[SW|Helicase C-terminal domain] (aa 820-974) (according to UniProt)
The protein
[SW|Localization]
cytoplasm (according to UniProt)