SubtiBank SubtiBank
Version comparison:

2019-02-04 15:57:122025-05-14 01:53:13

locus

BSU33040

BSU_33040

outlinks

bsu

BSU33040

BSU_33040

The protein

Catalyzed reaction/ biological activity

(S)-malate = fumarate + H2O (according to Swiss-Prot)

(S)-malate --> fumarate + H2O (according to UniProt)

The protein

Protein family

Fumarase subfamily (according to Swiss-Prot)

class-II fumarase/aspartase family (with [[protein|AnsB]], according to UniProt)

Biological materials

Mutant

GP718 (spec), available in [SW|Jrg Stlke]'s lab [pubmed|20933603]

GP2340 (''[[gene|citG]]''::''kan''), Cre-recombinase is integrated in ''[[gene|sacA]]'', available in [SW|Jrg Stlke]'s lab

GP2341 (''[[gene|citG]]''::''lox72''), Cre-recombinase is integrated in ''[[gene|sacA]]'', available in [SW|Jrg Stlke]'s lab

BKE33040 ([[gene|citG]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT

BKK33040 ([[gene|citG]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT

GP718 (spec), available in [SW|Jörg Stülke]'s lab [pubmed|20933603]

GP2340 Δ''[[gene|citG]]''::''kan'', Cre-recombinase is integrated in ''[[gene|sacA]]'', available in [SW|Jörg Stülke]'s lab

GP2341 Δ''[[gene|citG]]''::''lox72'', Cre-recombinase is integrated in ''[[gene|sacA]]'', available in [SW|Jörg Stülke]'s lab

BKE33040 ([[gene|citG]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT

BKK33040 ([[gene|citG]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT

Biological materials

Expression vectors

pGP1122 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Jrg Stlke]'s lab) [pubmed|20933603]

pGP1122 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Jörg Stülke]'s lab) [pubmed|20933603]

Biological materials

lacZ fusion

pGP387 (in [[protein|pAC7]]), available in [SW|Jrg Stlke]'s lab

pGP387 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab

Biological materials

GFP fusion

GP1433 (spc, based on [SW|pGP1870]), available in the [SW|Stlke] lab

GP1433 (spc, based on [SW|pGP1870]), available in the [SW|Jörg Stülke] lab

Biological materials

two-hybrid system

''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jrg Stlke]'s lab

''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab

Biological materials

FLAG-tag construct

GP1132 (spc, based on [SW|pGP1331]), available in [SW|Jrg Stlke]'s lab

GP1132 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab