2019-02-04 15:57:122025-05-14 01:53:13
locus
BSU33040
BSU_33040
outlinks
bsu
BSU33040
BSU_33040
The protein
Catalyzed reaction/ biological activity
(S)-malate = fumarate + H2O (according to Swiss-Prot)
(S)-malate --> fumarate + H2O (according to UniProt)
The protein
Protein family
Fumarase subfamily (according to Swiss-Prot)
class-II fumarase/aspartase family (with [[protein|AnsB]], according to UniProt)
Biological materials
Mutant
GP718 (spec), available in [SW|Jrg Stlke]'s lab [pubmed|20933603]
GP2340 (''[[gene|citG]]''::''kan''), Cre-recombinase is integrated in ''[[gene|sacA]]'', available in [SW|Jrg Stlke]'s lab
GP2341 (''[[gene|citG]]''::''lox72''), Cre-recombinase is integrated in ''[[gene|sacA]]'', available in [SW|Jrg Stlke]'s lab
BKE33040 ([[gene|citG]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT
BKK33040 ([[gene|citG]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT
GP718 (spec), available in [SW|Jörg Stülke]'s lab [pubmed|20933603]
GP2340 Δ''[[gene|citG]]''::''kan'', Cre-recombinase is integrated in ''[[gene|sacA]]'', available in [SW|Jörg Stülke]'s lab
GP2341 Δ''[[gene|citG]]''::''lox72'', Cre-recombinase is integrated in ''[[gene|sacA]]'', available in [SW|Jörg Stülke]'s lab
BKE33040 ([[gene|citG]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT
BKK33040 ([[gene|citG]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT
Biological materials
Expression vectors
pGP1122 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Jrg Stlke]'s lab) [pubmed|20933603]
pGP1122 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Jörg Stülke]'s lab) [pubmed|20933603]
Biological materials
lacZ fusion
pGP387 (in [[protein|pAC7]]), available in [SW|Jrg Stlke]'s lab
pGP387 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
Biological materials
GFP fusion
GP1433 (spc, based on [SW|pGP1870]), available in the [SW|Stlke] lab
GP1433 (spc, based on [SW|pGP1870]), available in the [SW|Jörg Stülke] lab
Biological materials
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jrg Stlke]'s lab
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
Biological materials
FLAG-tag construct
GP1132 (spc, based on [SW|pGP1331]), available in [SW|Jrg Stlke]'s lab
GP1132 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab