late competence protein required for DNA binding and uptake

dCMP deaminase, late competence protein required for DNA binding and uptake, recruitment of [[protein|ComGA]] to the cell pole

BSU25580

BSU_25580

567

570

genetic compentence

recruitment of [[protein|ComGA]] to the cell pole

late competence protein

dCMP deaminase

BSU25580

BSU_25580

2,639,877 → 2,640,446

2,639,877 2,640,446

cytidine and deoxycytidylate deaminase family (according to Swiss-Prot)

[SW|Cytidine and deoxycytidylate deaminase family] (according to UniProt)

cell membrane (according to Swiss-Prot)

localizes to one or both cell poles [Pubmed|21278288]

localizes to one or both cell poles [Pubmed|31954084,21278288]

BKE25580 (Δ[[gene|comEB]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTGTTCCCTCCAAATG, downstream forward: _UP4_CTTTTCACGAGCTACGTGTG

BKK25580 (Δ[[gene|comEB]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTGTTCCCTCCAAATG, downstream forward: _UP4_CTTTTCACGAGCTACGTGTG

BKE25580 ([[gene|comEB]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTGTTCCCTCCAAATG, downstream forward: _UP4_CTTTTCACGAGCTACGTGTG

BKK25580 ([[gene|comEB]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTGTTCCCTCCAAATG, downstream forward: _UP4_CTTTTCACGAGCTACGTGTG

11814663, 7968523, 21278288, 19028902, 18255096

11814663, 7968523, 21278288, 19028902, 18255096, 31954084

recruitment of [[protein|ComGA]] to the cell pole [pubmed|31954084]

deoxycytidylate monophosphate (dCMP) deaminase [pubmed|31954084]

[SW|CMP/dCMP-type deaminase domain] (aa 5–132) (according to UniProt)