BSU39920

BSU_39920

2241

2244

asparagine synthase (glutamine-hydrolysing))

asparagine synthase (glutamine-hydrolysing)

BSU39920

BSU_39920

4,098,926 → 4,101,169

4,098,926 4,101,169

ATP L-aspartate L-glutamine H₂O = AMP diphosphate L-asparagine L-glutamate (according to Swiss-Prot)

ATP + H₂O + L-aspartate + L-glutamine --> AMP + diphosphate + H⁺ + L-asparagine + L-glutamate (according to UniProt)

asparagine synthetase family (according to Swiss-Prot)

asparagine synthetase family (with [[protein|AsnB]] and [[protein|AsnO]], according to UniProt)

MGNA-B689 (asnH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1688 NBRP B. subtilis, Japan]

BKE39920 (Δ[[gene|asnH]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTCTCCCTCCCAATA, downstream forward: _UP4_AATCTGCCAGAAGGAGCATA

BKK39920 (Δ[[gene|asnH]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTCTCCCTCCCAATA, downstream forward: _UP4_AATCTGCCAGAAGGAGCATA

MGNA-B689 (asnH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1688 NBRP B. subtilis, Japan]

BKE39920 ([[gene|asnH]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTCTCCCTCCCAATA, downstream forward: _UP4_AATCTGCCAGAAGGAGCATA

BKK39920 ([[gene|asnH]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTCTCCCTCCCAATA, downstream forward: _UP4_AATCTGCCAGAAGGAGCATA

20185509, 10746760, 12618455, 10498721, 12618455, 15101989

20185509, 10746760, 12618455, 10498721, 12618455, 15101989, 10587437

[[this]]

[SW|Glutamine amidotransferase type-2 domain] (aa 2-218) (according to UniProt)

[PDB|1CT9] (from E. coli, corresponds to aa 30 ... 537, 27% identity) [pubmed|10587437]