SubtiBank SubtiBank
Version comparison:

2017-07-07 13:05:552025-05-14 20:41:34

description

high affinity potassium transporter [[protein|KtrA]]-[[protein|KtrB]], peripheric membrane component

high affinity potassium channel [[protein|KtrA]]-[[protein|KtrB]], peripheric membrane component

locus

BSU31090

BSU_31090

geneLength

666

669

product

high affinity potassium transporter [[protein|KtrA]]-[[protein|KtrB]], peripheric membrane component

high affinity potassium channel [[protein|KtrA]]-[[protein|KtrB]], peripheric membrane component

outlinks

bsu

BSU31090

BSU_31090

Gene

Coordinates

3,188,414 → 3,189,082

3,188,414 3,189,082

The protein

Paralogous protein(s)

[[protein|KtrC]]

[[this]]

The protein

[SW|Domains]

contains a [SW|RCK_N domain] at the N-terminus (according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])

contains a [SW|RCK_C domain] at the C-terminus (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt])

contains a [SW|RCK_N domain] at the N-terminus (aa 8-130) (according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])

contains a [SW|RCK_C domain] at the C-terminus (aa 139-222) (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt])

Biological materials

Mutant

MGNA-B543 (yuaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1542 NBRP B. subtilis, Japan]

1A954 ( ''ktrA''::''kan''), [Pubmed|12562800], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A954&Search=1A954 BGSC]

GHB1 (Δ[[gene|ktrA]]-[[gene|ktrB]]::''aphA3''), available in [SW|Erhard Bremer]'s lab

GP92 (Δ[[gene|ktrA]]-[[gene|ktrB]]::''aphA3''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]

GP2083 (Δ[[gene|ktrA]]-[[gene|ktrB]]::''aphA3'' Δ[[gene|ktrC]]::''tet''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]

MGNA-B543 (yuaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1542 NBRP B. subtilis, Japan]

1A954 ( ''ktrA''::''kan''), [Pubmed|12562800], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A954&Search=1A954 BGSC]

GHB1 ([[gene|ktrA]]-[[gene|ktrB]]::''aphA3''), available in [SW|Erhard Bremer]'s lab

GP92 ([[gene|ktrA]]-[[gene|ktrB]]::''aphA3''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]

GP2083 ([[gene|ktrA]]-[[gene|ktrB]]::''aphA3'' [[gene|ktrC]]::''tet''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]

GP2498 ([[gene|ktrA]]-[[gene|ktrB]]::''spc'' [[gene|kimA]]::''cat''), available in [SW|Jörg Stülke]'s lab

BKE31090 ([[gene|ktrA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTTCATATCTCCCTTA, downstream forward: _UP4_GAAAACGAAGGGATGTAGAC

BKK31090 ([[gene|ktrA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTTCATATCTCCCTTA, downstream forward: _UP4_GAAAACGAAGGGATGTAGAC

GP2716 ([[gene|ktrA]]-[[gene|ktrB]]::''spc''), available in [SW|Jörg Stülke]'s lab

GP3065 ([[gene|ktrA]]::''kan''), available in [SW|Jörg Stülke]'s lab

Biological materials

Expression vector

pGP2594: (IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

Biological materials

lacZ fusion

GP2176 (based on [SW|pAC5]), available in [SW|Jörg Stülke]'s lab

GP2177 (based on [SW|pAC7]), available in [SW|Jörg Stülke]'s lab

GP2176 (based on [SW|pAC5]), available in [SW|Jörg Stülke]'s lab

GP2177 (based on [SW|pAC7]), available in [SW|Jörg Stülke]'s lab

GP2299 (based on [SW|pAC6]), available in [SW|Jörg Stülke]'s lab [pubmed|28679749]

Labs working on this gene/protein

[SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]

References

Reviews

25869574, 27935846, 28086088

25869574, 27935846, 28086088, 28825218, 25838295, 31361596, 32095817, 32603625

References

Original publications

12562800, 15096624, 16321950, 20511502, 23086297, 23598340, 24141192, 25957408, 16990138, 26771197, 28086091, 28420751, 28504641, 28679749

12562800, 15096624, 16321950, 20511502, 23086297, 23598340, 24141192, 25957408, 16990138, 26771197, 28086091, 28420751, 28504641, 28679749, 30753894, 31061098, 31868587, 32253343

The protein

Protein family

KtrA potassium transport family (with [[protein|KtrC]], according to UniProt)

The protein

Kinetic information

the [[protein|KtrA]]-[[protein|KtrB]] channel has a high affinity for potassium,this is determined by [[protein|KtrB]] [pubmed|30753894]

The protein

[SW|Cofactors]

Mg2+ (cofactor in the nucleotide-dependent activation of [[protein|KtrA]]-[[protein|KtrB]] by binding at the intra-dimer [[protein|KtrA]] interface site) [pubmed|31868587]

The protein

Effectors of protein activity

binds ADP and ATP [pubmed|26771197]

activity is inhibited upon binding of c-di-AMP [pubmed|30753894,31061098]

Expression and Regulation

additional information

growth at extreme potassium limitation results in the acquisition of promoter mutations with increased [[gene|ktrA]]-[[gene|ktrB]] expression [pubmed|28679749]

Biological materials

Expression vectors

pGP2594: (IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

labs

[SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi Homepage]

[SW|Inga Hänelt], Frankfurt, Germany [https://www.biochem.uni-frankfurt.de/index.php?id=298 Homepage]

[SW|João H Morais-Cabral], University of Porto, Portugal [https://www.i3s.up.pt/research-group?x=47 Homepage]

[SW|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]