2017-05-21 19:30:052025-03-30 22:31:18
description
high affinity potassium transporter KtrA-KtrB, peripheric membrane component (proton symport)
high affinity potassium channel [[protein|KtrA]]-[[protein|KtrB]], peripheric membrane component
locus
BSU31090
BSU_31090
geneLength
666
669
product
high affinity potassium transporter KtrA-KtrB, peripheric membrane component (proton symport)
high affinity potassium channel [[protein|KtrA]]-[[protein|KtrB]], peripheric membrane component
outlinks
bsu
BSU31090
BSU_31090
Gene
Coordinates
3,188,414 → 3,189,082
3,188,414 3,189,082
Gene
Phenotypes of a mutant
The ''[[gene|ktrA]]-[[gene|ktrB]]'' mutant of ''B. subtilis'' NCIB3610 is reduced in sliding (dendritic spreading) [Pubmed|16321950]
a [[gene|kimA ]][[gene|ktrA ]][[gene|ktrB]] mutant requires high potassium concentrations on minimal medium with ammonium as nitrogen source [pubmed|28420751,28679749]
a [[gene|ktrA]]-[[gene|ktrB]] mutant of ''B. subtilis'' NCIB3610 is reduced in sliding (dendritic spreading) [Pubmed|16321950]
The protein
Paralogous protein(s)
[[protein|KtrC]]
[[this]]
The protein
[SW|Domains]
contains a [SW|RCK_N domain] at the N-terminus (according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])
contains a [SW|RCK_C domain] at the C-terminus (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt])
contains a [SW|RCK_N domain] at the N-terminus (aa 8-130) (according to [http://www.uniprot.org/uniprot/?query=RCK+N-terminal+domain&sort=score UniProt])
contains a [SW|RCK_C domain] at the C-terminus (aa 139-222) (according to [http://www.uniprot.org/uniprot/?query=RCK+C-terminal+domain&sort=score UniProt])
Biological materials
Mutant
MGNA-B543 (yuaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1542 NBRP B. subtilis, Japan]
1A954 ( ''ktrA''::''kan''), [Pubmed|12562800], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A954&Search=1A954 BGSC]
GHB1 (D(''[[gene|ktrA]]-[[gene|ktrB]]'')::''aphA3''), available in [SW|Erhard Bremer]'s lab
GP92 (D(''[[gene|ktrA]]-[[gene|ktrB]]'')::''aphA3''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
GP2083 (D(''[[gene|ktrA]]-[[gene|ktrB]]'')::''aphA3'' D''[[gene|ktrC]]''::''tet''), available in [SW|Jörg Stülke]'s lab
MGNA-B543 (yuaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1542 NBRP B. subtilis, Japan]
1A954 ( ''ktrA''::''kan''), [Pubmed|12562800], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A954&Search=1A954 BGSC]
GHB1 ([[gene|ktrA]]-[[gene|ktrB]]::''aphA3''), available in [SW|Erhard Bremer]'s lab
GP92 ([[gene|ktrA]]-[[gene|ktrB]]::''aphA3''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
GP2083 ([[gene|ktrA]]-[[gene|ktrB]]::''aphA3'' [[gene|ktrC]]::''tet''), available in [SW|Jörg Stülke]'s lab [pubmed|28420751]
GP2498 ([[gene|ktrA]]-[[gene|ktrB]]::''spc'' [[gene|kimA]]::''cat''), available in [SW|Jörg Stülke]'s lab
BKE31090 ([[gene|ktrA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTTCATATCTCCCTTA, downstream forward: _UP4_GAAAACGAAGGGATGTAGAC
BKK31090 ([[gene|ktrA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTTCATATCTCCCTTA, downstream forward: _UP4_GAAAACGAAGGGATGTAGAC
GP2716 ([[gene|ktrA]]-[[gene|ktrB]]::''spc''), available in [SW|Jörg Stülke]'s lab
GP3065 ([[gene|ktrA]]::''kan''), available in [SW|Jörg Stülke]'s lab
Biological materials
Expression vector
pGP2594: (IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
Biological materials
lacZ fusion
GP2176 (based on [SW|pAC5]), available in [SW|Jörg Stülke]'s lab
GP2177 (based on [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
GP2176 (based on [SW|pAC5]), available in [SW|Jörg Stülke]'s lab
GP2177 (based on [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
GP2299 (based on [SW|pAC6]), available in [SW|Jörg Stülke]'s lab [pubmed|28679749]
Labs working on this gene/protein
[SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi homepage]
References
Reviews
References
Original publications
The protein
Protein family
KtrA potassium transport family (with [[protein|KtrC]], according to UniProt)
The protein
Kinetic information
the [[protein|KtrA]]-[[protein|KtrB]] channel has a high affinity for potassium,this is determined by [[protein|KtrB]] [pubmed|30753894]
The protein
[SW|Cofactors]
Mg2+ (cofactor in the nucleotide-dependent activation of [[protein|KtrA]]-[[protein|KtrB]] by binding at the intra-dimer [[protein|KtrA]] interface site) [pubmed|31868587]
The protein
Effectors of protein activity
binds ADP and ATP [pubmed|26771197]
activity is inhibited upon binding of c-di-AMP [pubmed|30753894,31061098]
Expression and Regulation
additional information
growth at extreme potassium limitation results in the acquisition of promoter mutations with increased [[gene|ktrA]]-[[gene|ktrB]] expression [pubmed|28679749]
Biological materials
Expression vectors
pGP2594: (IPTG inducible expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
labs
[SW|Erhard Bremer], University of Marburg, Germany [http://www.uni-marburg.de/fb17/fachgebiete/mikrobio/molmibi Homepage]
[SW|Inga Hänelt], Frankfurt, Germany [https://www.biochem.uni-frankfurt.de/index.php?id=298 Homepage]
[SW|João H Morais-Cabral], University of Porto, Portugal [https://www.i3s.up.pt/research-group?x=47 Homepage]
[SW|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]