SubtiBank SubtiBank
Version comparison:

2017-04-24 15:34:122025-05-28 08:38:59

locus

BSU16170

BSU_16170

geneLength

777

780

ec

outlinks

bsu

BSU16170

BSU_16170

Gene

Coordinates

1,690,119 → 1,690,898

1,690,119 1,690,898

The protein

Protein family

codY family (according to Swiss-Prot)

codY family (single member, according to UniProt)

Biological materials

Mutant

GP566, available in [SW|Jörg Stülke]'s lab

a ''[[gene|codY]]::erm'' mutant is available in [SW|Linc Sonenshein]'s lab

a ''[[gene|codY]]::spc'' (BB1043) mutant is available in [SW|Linc Sonenshein]'s, [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs

BKE16170 (''codY''::''erm trpC2'') is available from the [http://bgsc.org Bacillus Genetic Stock Center]

GP566 available in [SW|Jörg Stülke]'s lab

GP2473 (''[[gene|codY]]''::''spc''), available in [SW|Jörg Stülke]'s lab

a ''[[gene|codY]]::erm'' mutant is available in [SW|Linc Sonenshein]'s lab

a ''[[gene|codY]]::spc'' (BB1043) mutant is available in [SW|Linc Sonenshein]'s, [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs

BKE16170 ([[gene|codY]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAATAATCCTCCTA, downstream forward: _UP4_TAATCACAAAAAGAACCCTT

BKK16170 ([[gene|codY]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATAAATAATCCTCCTA, downstream forward: _UP4_TAATCACAAAAAGAACCCTT

Biological materials

Expression vector

for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP245, available in [SW|Jörg Stülke]'s lab

Labs working on this gene/protein

[SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]

[SW|Tony Wilkinson], York University, U.K. [http://www.york.ac.uk/depts/chem/staff/ajw.html Homepage]

[SW|Oscar Kuipers], University of Groningen, The Netherlands, [http://molgen.biol.rug.nl/molgen/index.php Homepage]

References

The [SW|CodY regulon]

18083814, 12618455, 23569278, 24843172

18083814, 12618455, 23569278, 24843172, 31944451

References

Original Publications

19542274, 17493123, 18641142, 19202088, 16995897, 17993518, 9287005, 11331605, 17218307, 19500589, 12591885, 19202088, 11331605, 15228537, 8793880, 26170408, 15937175, 15916605, 15916606, 11331605, 15228537, 19749041, 7783641, 20935095, 21097623, 21699902, 21764931, 22981860, 22512862, 21856856, 23911932, 24296669, 24163341, 25157083, 25645558, 24682323, 25666135, 25966844, 26220295, 26473603, 26728191, 27596595, 28011634

19542274, 17493123, 18641142, 19202088, 16995897, 17993518, 9287005, 11331605, 17218307, 19500589, 12591885, 19202088, 11331605, 15228537, 8793880, 26170408, 15937175, 15916605, 15916606, 11331605, 15228537, 19749041, 7783641, 20935095, 21097623, 21699902, 21764931, 22981860, 22512862, 21856856, 23911932, 24296669, 24163341, 25157083, 25645558, 24682323, 25666135, 25966844, 26220295, 26473603, 26728191, 27596595, 28011634, 28371347, 30096425, 16488888

The protein

Paralogous protein(s)

[[this]]

The protein

additional information

information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000045 PRODORIC2 database]

Biological materials

Expression vectors

pGP244 (for expression, purification in ''E. coli'' with Thrombin-cleavable N-terminal His-tag, in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

pBP616 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Fabian Commichau]'s lab)

pBP618 (C-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP382]) (available in [SW|Fabian Commichau]'s lab)

labs

[SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]

[SW|Tony Wilkinson], York University, U.K. [http://www.york.ac.uk/depts/chem/staff/ajw.html Homepage]

[SW|Oscar Kuipers], University of Groningen, The Netherlands, [http://molgen.biol.rug.nl/molgen/index.php Homepage]