primary bacitracin resistance determinant, ABC transporter (ATP-binding protein) for the export of bacitracin, plectasin, mersacidin and actagardine

primary bacitracin resistance determinant, [SW|ABC transporter] (ATP-binding protein), protects cell wall biosynthetic targets from inhibition by antimicrobial peptides

BSU30380

BSU_30380

759

762

export of toxic peptides

protection of cell wall biosynthetic targets from inhibition by antimicrobial peptides

bacitracin ABC transporter (ATP-binding protein)

[SW|ABC transporter] (ATP-binding protein) for target protection of cell wall synthesis

BSU30380

BSU_30380

3,111,327 → 3,112,088

3,111,327 3,112,088

[SW|ABC transporter] family (according to Swiss-Prot)

[SW|ABC transporter] family (according to UniProt)

MGNA-A167 (ytsC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/167 NBRP B. subtilis, Japan]

GP3218 Δ([[gene|bceR]]-[[gene|bceS]]-[[gene|bceA]]-[[gene|bceB]])::''cat'', available in [SW|Jörg Stülke]'s lab

MGNA-A167 (ytsC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/167 NBRP B. subtilis, Japan]

BKE30380 ([[gene|bceA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTACGCAGTCTCCTTTA, downstream forward: _UP4_CAAGGCGTGTTAGGCGGGGT

BKK30380 ([[gene|bceA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTACGCAGTCTCCTTTA, downstream forward: _UP4_CAAGGCGTGTTAGGCGGGGT

Foglino M. [Pubmed|17905982]

27344142, 28152228

27344142, 28152228, 29404338

17905982, 18394148, 12890034, 14651641, 10092453, 14612242, 21283517, 20606066, 21078927, 23687272, 24806199, 25118291, 26199330, 26364265, 12150914, 27997719, 26815905

17905982, 18394148, 12890034, 14651641, 10092453, 14612242, 21283517, 20606066, 21078927, 23687272, 24806199, 25118291, 26199330, 26364265, 12150914, 27997719, 26815905, 31871088, 32019833, 32955745

releaves intermediates of the lipid II cycle from the inhibitory interaction with antimicrobial peptides such as bacitracin [pubmed|31871088]

[[this]]

[SW|ABC transporter domain] (aa 4-243) (according to UniProt)

[SW|Susanne Gebhard], Bath UK