2019-12-27 10:55:022025-06-15 18:33:31
Gene
Phenotypes of a mutant
drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
''[[gene|recO]] [[gene|recJ]]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]
''[[gene|recO]] [[gene|dprA]]'' double mutants have a strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]
''[[gene|recO]] [[gene|addA]]-[[gene|addB]]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]
drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
''[[gene|recO]] [[gene|recJ]]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]
''[[gene|recO]] [[gene|dprA]]'' double mutants have a strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]
''[[gene|recO]] [[gene|addA]]-[[gene|addB]]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]
reduced viability of a [[gene|rarA]] [[gene|recO]] double mutant [pubmed|32117122]
suppression of lethality of [[gene|pcrA]] inactivation [pubmed|32793628]
The protein
Catalyzed reaction/ biological activity
provides [[protein|RecA]] access to ssDNA during chromosomal transformation (together with [[protein|DprA]]) [Pubmed|22373918]
catalyzes annealing of [[protein|SsbA]] or [[protein|SsbA]]/[[protein|SsbB]] coated ssDNAs to allow the formation of DNA duplexes with tails during plasmid transformation [Pubmed|22373918]
required for the formation of [[protein|RecA]] DNA repair centers (together with [[protein|RecR]]) [Pubmed|24891441]
anneals [[protein|SsbA]]- or [[protein|SsbB]]-coated complementary strands of transfecting SPP1 phage DNA, yielding tailed SPP1 duplex intermediates [pubmed|31876108]
provides [[protein|RecA]] access to ssDNA during chromosomal transformation (together with [[protein|DprA]]) [Pubmed|22373918]
catalyzes annealing of [[protein|SsbA]] or [[protein|SsbA]]/[[protein|SsbB]] coated ssDNAs to allow the formation of DNA duplexes with tails during plasmid transformation [Pubmed|22373918]
required for the formation of [[protein|RecA]] DNA repair centers (together with [[protein|RecR]]) [Pubmed|24891441]
anneals [[protein|SsbA]]- or [[protein|SsbB]]-coated complementary strands of transfecting SPP1 phage DNA, yielding tailed SPP1 duplex intermediates [pubmed|31876108]
[[protein|DprA]], [[protein|RecO]] or viral single strand annealing G35P protein, may catalyze the annealing of complete linear phage genomes with redundant regions at the ends of the molecule, alone or with the help of an exonuclease, to produce a circular unit-length duplex viral genome ready to initiate replication [pubmed|31876108]
Biological materials
Mutant
MGNA-C494 (yqxN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2492 NBRP B. subtilis, Japan]
1A892 ( ''recO''::''cat''), [Pubmed|10323239], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A892&Search=1A892 BGSC]
BKE25280 ( ''recO''::''ermC''), (available at the [http://www.bgsc.org/ BGSC] and in [SW|Fabian Commichau]'s lab) [pubmed|28189581]
BP738 ( ''recO''::''tet''), (available in [SW|Fabian Commichau]'s lab)
BP774 ( ''recO''::''ermC''), (available in [SW|Fabian Commichau]'s lab)
BKE25280 ([[gene|recO]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCACCTTCCTCAA, downstream forward: _UP4_TGACATTTGGTCCATCTTTT
BKK25280 ([[gene|recO]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCACCTTCCTCAA, downstream forward: _UP4_TGACATTTGGTCCATCTTTT
GP3527 (Δ[[gene|recO]]::kan), available in [SW|Jörg Stülke]'s lab
MGNA-C494 (yqxN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2492 NBRP B. subtilis, Japan]
1A892 ( ''recO''::''cat''), [Pubmed|10323239], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A892&Search=1A892 BGSC]
BG128 (Δ[[gene|recO]]::cat), available in [SW|Juan Alonso]'s and [SW|Jörg Stülke]'s labs [pubmed|9642195]
BP738 ( Δ''recO''::''tet''), (available in [SW|Fabian Commichau]'s lab)
BP774 ( Δ''recO''::''ermC''), (available in [SW|Fabian Commichau]'s lab)
BKE25280 (Δ[[gene|recO]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCACCTTCCTCAA, downstream forward: _UP4_TGACATTTGGTCCATCTTTT
BKK25280 (Δ[[gene|recO]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCACCTTCCTCAA, downstream forward: _UP4_TGACATTTGGTCCATCTTTT
References
Reviews
References
Original publications