SubtiBank SubtiBank
Version comparison:

2020-03-05 10:18:352025-05-25 12:44:27

Gene

Phenotypes of a mutant

drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]

''[[gene|recO]] [[gene|recJ]]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]

''[[gene|recO]] [[gene|dprA]]'' double mutants have a strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]

''[[gene|recO]] [[gene|addA]]-[[gene|addB]]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]

drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]

''[[gene|recO]] [[gene|recJ]]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]

''[[gene|recO]] [[gene|dprA]]'' double mutants have a strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]

''[[gene|recO]] [[gene|addA]]-[[gene|addB]]'' double mutants are extremely sensitive against DNA damaging agents [Pubmed|26001966]

reduced viability of a [[gene|rarA]] [[gene|recO]] double mutant [pubmed|32117122]

suppression of lethality of [[gene|pcrA]] inactivation [pubmed|32793628]

Biological materials

Mutant

MGNA-C494 (yqxN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2492 NBRP B. subtilis, Japan]

1A892 ( ''recO''::''cat''), [Pubmed|10323239], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A892&Search=1A892 BGSC]

BP738 ( ''recO''::''tet''), (available in [SW|Fabian Commichau]'s lab)

BP774 ( ''recO''::''ermC''), (available in [SW|Fabian Commichau]'s lab)

BKE25280 ([[gene|recO]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCACCTTCCTCAA, downstream forward: _UP4_TGACATTTGGTCCATCTTTT

BKK25280 ([[gene|recO]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCACCTTCCTCAA, downstream forward: _UP4_TGACATTTGGTCCATCTTTT

GP3527 (Δ[[gene|recO]]::kan), available in [SW|Jörg Stülke]'s lab

MGNA-C494 (yqxN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2492 NBRP B. subtilis, Japan]

1A892 ( ''recO''::''cat''), [Pubmed|10323239], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A892&Search=1A892 BGSC]

BG128 (Δ[[gene|recO]]::cat), available in [SW|Juan Alonso]'s and [SW|Jörg Stülke]'s labs [pubmed|9642195]

BP738 ( Δ''recO''::''tet''), (available in [SW|Fabian Commichau]'s lab)

BP774 ( Δ''recO''::''ermC''), (available in [SW|Fabian Commichau]'s lab)

BKE25280 (Δ[[gene|recO]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCACCTTCCTCAA, downstream forward: _UP4_TGACATTTGGTCCATCTTTT

BKK25280 (Δ[[gene|recO]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCCGCACCTTCCTCAA, downstream forward: _UP4_TGACATTTGGTCCATCTTTT

References

Reviews

22933559

22933559, 32286623

References

Original publications

24891441, 18599486, 19730681, 20581116, 22373918, 17581636, 21170359, 24285298, 24285298, 25939832, 26001966, 15186413, 10323239, 26786319, 23779106, 30401797, 31876108

24891441, 18599486, 19730681, 20581116, 22373918, 17581636, 21170359, 24285298, 24285298, 25939832, 26001966, 15186413, 10323239, 26786319, 23779106, 30401797, 31876108, 32117122, 32793628