protein serine phosphatase, septum-associated PP2C, dephosphorylation of SpoIIAA

protein serine phosphatase, septum-associated PP2C, dephosphorylation of [[protein|SpoIIAA]]

BSU00640

BSU_00640

2481

2484

control of SigF activity
required for normal formation of the asymmetric septum

control of [[protein|SigF ]]activity, required for normal formation of the asymmetric septum

BSU00640

BSU_00640

70,538 -> 73,021

70,538 73,021

dephosphorylation of [[protein|SpoIIAA]]

dephosphorylation of [[protein|SpoIIAA]] (according to UniProt)

stabilization of [[protein|ftsZ ]]oligomers [pubmed|28358838]

H₂O + O-phospho-L-seryl-[protein] --> L-seryl-[protein] + phosphate (according to UniProt)

H₂O + O-phospho-L-threonyl-[protein] --> L-threonyl-[protein] + phosphate (according to UniProt)

[PDB|3T91] (phosphatase domain) [Pubmed|22115775]

[PDB|5UCG] [pubmed|28527238]

[PDB|3T91] (phosphatase domain) [Pubmed|22115775]

cell membrane (according to Swiss-Prot)

localizes to the polar cell division sites where it causes [[protein|FtsZ]] to relocate from mid-cell to form polar Z-rings

forespore [Pubmed|26465112]

localizes to the cell poles (via [[protein|DivIVA]]) [Pubmed|26465112]

proper localization and stability depend on [[protein|SpoIIQ]] [Pubmed|26929302]

cell membrane [pubmed|28358838]

localizes to the polar cell division sites where it causes [[protein|FtsZ]] to relocate from mid-cell to form polar Z-rings

forespore [Pubmed|26465112]

localizes to the cell poles (via [[protein|DivIVA]]) [Pubmed|26465112]

proper localization and stability depend on [[protein|SpoIIQ]] [Pubmed|26929302]

MGNA-A083 (spoIIE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/83 NBRP B. subtilis, Japan]

MGNA-A083 (spoIIE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/83 NBRP B. subtilis, Japan]

BKE00640 ([[gene|spoIIE]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCTCATCTCCCACC, downstream forward: _UP4_TAACGCTTCCGTATAAATCA

BKK00640 ([[gene|spoIIE]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCTCATCTCCCACC, downstream forward: _UP4_TAACGCTTCCGTATAAATCA

[SW|Imrich Barak], Slovak Academy of Science, Bratislava, Slovakia [http://imb.savba.sk/~barak/ homepage]

27415800, 7570023, 7570022, 12180929, 9077448, 9364910, 10323866, 8622920, 12007411, 16824103, 10476035, 10747015, 10322028, 15978076, 9495766, 14744853, 9642177, 15866939, 8846916, 1556084, 1948031, 9573053, 18077456, 11846550, 9150232, 15205443, 1556084, 15687200, 19578359, 10049355, 20817757, 22115775, 25101664, 11846550, 26465112, 26929302, 28358838

27415800, 7570023, 7570022, 12180929, 9077448, 9364910, 10323866, 8622920, 12007411, 16824103, 10476035, 10747015, 10322028, 15978076, 9495766, 14744853, 9642177, 15866939, 8846916, 1556084, 1948031, 9573053, 18077456, 11846550, 9150232, 15205443, 1556084, 15687200, 19578359, 10049355, 20817757, 22115775, 25101664, 11846550, 26465112, 26929302, 28358838, 28527238, 30092000, 32630428

delay of the formation of polar [[protein|FtsZ ]]rings during [SW|sporulation] [pubmed|28358838]

[[this]]

N-terminal trans-membrane domain [pubmed|28358838]

central oligomerization and FtsZ interaction domain [pubmed|28358838]

C-terminal PP2C phosphatase domain [pubmed|28358838]

[SW|PPM-type phosphatase domain] (aa 594-804) (according to UniProt)

[SW|Imrich Barak], Slovak Academy of Science, Bratislava, Slovakia [http://imb.savba.sk/~barak/ homepage]

28500523, 30855188, 31350897