protein arginine kinase, tags proteins for degradation by ClpCP, adaptor protein, modulator of CtsR-dependent repression

protein arginine kinase, tags proteins for degradation by [[protein|ClpC]]-[[protein|ClpP]], adaptor protein, modulator of [[protein|CtsR]]-dependent repression

BSU00850

BSU_00850

1089

1092

control of CtsR activity

control of [[protein|CtsR]] activity

BSU00850

BSU_00850

102,484 → 103,575

102,484 103,575

phosphorylates and thereby targets non-functional CtsR for degradation by [[protein|ClpP]]/[[protein|ClpC]] [Pubmed|20852588]

phosphorylates and thereby targets non-functional [[protein|CtsR]] for degradation by [[protein|ClpP]]/[[protein|ClpC]] [Pubmed|20852588]

phosphorylates and thereby targets [[protein|MgsR]] for degradation by [[protein|ClpP]]/[[protein|ClpX]] [Pubmed|32477307]

ATP + L-arginyl-[protein] --> ADP + H⁺ + N^ω-phospho-L-arginyl-[protein] (according to UniProt)

ATP:guanido phosphotransferase family (according to Swiss-Prot)

ATP:guanido phosphotransferase family (single member, according to UniProt)

autophosphorylation on specific arginine residues [Pubmed|20852588,21622759], dephosphorylation by [[protein|YwlE]] [Pubmed|20852588,21622759]

autophosphorylation stimulates McsB activity as adaptor protein for [[protein|ClpC]] [Pubmed|21622759]

autophosphorylation on specific arginine residues [Pubmed|20852588,21622759], dephosphorylation by [[protein|YwlE]] [Pubmed|20852588,21622759]

autophosphorylation stimulates [[protein|McsB]] activity as adaptor protein for [[protein|ClpC]] [Pubmed|21622759]

MGNA-B930 (yacI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1929 NBRP B. subtilis, Japan]

''mcsB::aphA3'' availbale from the Gerth lab

mcsBC167S::spec available from the Gerth lab

GP1457 (''mcsB''::''aphA3''), available in [SW|Jörg Stülke]'s lab

BP69 (spc), available in [SW|Fabian Commichau]'s lab

MGNA-B930 (yacI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1929 NBRP B. subtilis, Japan]

''mcsB::aphA3'' availbale from the Gerth lab

mcsBC167S::spec available from the Gerth lab

GP1457 (''mcsB''::''aphA3''), available in [SW|Jörg Stülke]'s lab

BP69 (spc), available in [SW|Fabian Commichau]'s lab

BKE00850 ([[gene|mcsB]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG, downstream forward: _UP4_AAAAGACAGGAGGATGAATC

BKK00850 ([[gene|mcsB]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG, downstream forward: _UP4_AAAAGACAGGAGGATGAATC

for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab

expression of native ''mcsB'' in ''B. subtilis'': pBP186 (in [SW|pBQ200]), available in [SW|Fabian Commichau]'s lab

[SW|Ulf Gerth], Greifswald, Germany

[SW|Fabian Commichau] Göttingen, Germany

17380125, 16163393, 19498169, 11179229, 9987115, 8793870, 16497325, 19226326, 9987115, 11544224, 20852588, 21622759, 22517742, 24825175, 24263382, 25610436, 26458230, 27749819

17380125, 16163393, 19498169, 11179229, 9987115, 8793870, 16497325, 19226326, 9987115, 11544224, 20852588, 21622759, 22517742, 24825175, 24263382, 25610436, 26458230, 27749819, 30962626, 31221751, 32477307, 33101263

more rapid spore germination as compared to wild type cells [pubmed|31221751]

[[this]]

Phosphagen kinase C-terminal (aa 24-254) (according to UniProt)

[PDB|6FH1] [pubmed|30962626]

cytoplasm (according to UniProt)

for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab

expression of native ''mcsB'' in ''B. subtilis'': pBP186 (in [SW|pBQ200]), available in [SW|Fabian Commichau]'s lab

[SW|Ulf Gerth], Greifswald, Germany