locus

BSU00850

BSU_00850

outlinks

bsu

BSU00850

BSU_00850

The protein

Catalyzed reaction/ biological activity

phosphorylates and thereby targets non-functional [[protein|CtsR]] for degradation by [[protein|ClpP]]/[[protein|ClpC]] [Pubmed|20852588]

phosphorylates and thereby targets [[protein|MgsR]] for degradation by [[protein|ClpP]]/[[protein|ClpX]] [Pubmed|32477307]

ATP + L-arginyl-[protein] --> ADP + H⁺ + N^ω-phospho-L-arginyl-[protein] (according to UniProt)

The protein

Protein family

ATP:guanido phosphotransferase family (according to Swiss-Prot)

ATP:guanido phosphotransferase family (single member, according to UniProt)

The protein

Structure

[PDB|1BG0] (arginine kinase from Limulus polyphemus, corresponding to aa 20 ... 254, 29% identity) [pubmed|9671698]

[PDB|6FH1] [pubmed|30962626]

Biological materials

Mutant

MGNA-B930 (yacI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1929 NBRP B. subtilis, Japan]

''mcsB::aphA3'' availbale from the Gerth lab

mcsBC167S::spec available from the Gerth lab

GP1457 (''mcsB''::''aphA3''), available in [SW|Jrg Stlke]'s lab

BP69 (spc), available in [SW|Fabian Commichau]'s lab

BKE00850 ([[gene|mcsB]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG, downstream forward: _UP4_AAAAGACAGGAGGATGAATC

BKK00850 ([[gene|mcsB]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG, downstream forward: _UP4_AAAAGACAGGAGGATGAATC

MGNA-B930 (yacI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1929 NBRP B. subtilis, Japan]

''mcsB::aphA3'' availbale from the Gerth lab

mcsBC167S::spec available from the Gerth lab

GP1457 (''mcsB''::''aphA3''), available in [SW|Jörg Stülke]'s lab

BP69 (spc), available in [SW|Fabian Commichau]'s lab

BKE00850 ([[gene|mcsB]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG, downstream forward: _UP4_AAAAGACAGGAGGATGAATC

BKK00850 ([[gene|mcsB]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTGAATAAAATGCTTTAGCG, downstream forward: _UP4_AAAAGACAGGAGGATGAATC

labs

[SW|Ulf Gerth], Greifswald, Germany

[SW|Fabian Commichau] Gttingen, Germany

[SW|Ulf Gerth], Greifswald, Germany

References

Original Publications

17380125, 16163393, 19498169, 11179229, 9987115, 8793870, 16497325, 19226326, 9987115, 11544224, 20852588, 21622759, 22517742, 24825175, 24263382, 25610436, 26458230, 27749819, 9671698

17380125, 16163393, 19498169, 11179229, 9987115, 8793870, 16497325, 19226326, 9987115, 11544224, 20852588, 21622759, 22517742, 24825175, 24263382, 25610436, 26458230, 27749819, 30962626, 31221751, 32477307, 33101263

Gene

Phenotypes of a mutant

more rapid spore germination as compared to wild type cells [pubmed|31221751]

The protein

[SW|Domains]

Phosphagen kinase C-terminal (aa 24-254) (according to UniProt)

The protein

[SW|Localization]

cytoplasm (according to UniProt)