2018-04-08 18:07:502025-05-10 23:37:32
locus
BSU21920
BSU_21920
geneLength
1146
1149
outlinks
bsu
BSU21920
BSU_21920
Gene
Coordinates
2,306,514 → 2,307,662
2,306,514 2,307,662
Gene
Phenotypes of a mutant
cells are bent and distended due to the lack of glucolipids [Pubmed|22362028,27684739]
increased expression of the [[protein|SigM]], [[protein|SigV]], and [[protein|SigX]] regulons [Pubmed|22362028]
altered [SW|localization] of [[protein|MreB]] (irregular clusters instead of helical dots) [Pubmed|22362028]
the inactivation of ''[[gene|ugtP]]'' suppresses the poor and filamentous growth of the ''[[gene|whiA]] [[gene|zapA]]'' double mutant [Pubmed|24097947]
increased conjugation of ICEBs1 [Pubmed|25069588,26833415]
increased levels of cell wall precursors [pubmed|33087775]
cells are bent and distended due to the lack of glucolipids [Pubmed|22362028,27684739]
a [[gene|ugtP]] [[gene|lytE]] double mutant has a severe [SW|cell shape] defect, thi can be suppressed by mutations resulting in reduced expression or activity of [[protein|PonA|PbpA]] [pubmed|33087775]
increased expression of the [[protein|SigM]], [[protein|SigV]], and [[protein|SigX]] regulons [Pubmed|22362028]
altered [SW|localization] of [[protein|MreB]] (irregular clusters instead of helical dots) [Pubmed|22362028]
the inactivation of ''[[gene|ugtP]]'' suppresses the poor and filamentous growth of the ''[[gene|whiA]] [[gene|zapA]]'' double mutant [Pubmed|24097947]
increased conjugation of ICEBs1 [Pubmed|25069588,26833415]
The protein
Catalyzed reaction/ biological activity
UDP-glucose + 1,2-diacylglycerol = UDP + 1,2-diacyl-3-(O-beta-D-glucopyranosyl)-sn-glycerol (according to Swiss-Prot)
the interaction with [[protein|FtsZ]] results in inhibition of [SW|cell division] and an increase of cell size [Pubmed|22931116]
1,2-diacyl-3-O-(β-D-glucopyranosyl)-sn-glycerol + UDP-α-D-glucose --> 1,2-diacyl-3-O-(β-D-Glc-(1→6)-β-D-Glc)-sn-glycerol + H+ + UDP (according to UniProt)
1,2-diacyl-3-O-(β-D-Glc-(1→6)-β-D-Glc)-sn-glycerol + UDP-α-D-glucose --> 1,2-diacyl-3-O-(β-D-Glc-(1→6)-β-D-Glc-(1→6)-β-D-Glc)-sn-glycerol + H+ + UDP (according to UniProt)
1,2-diacyl-sn-glycerol + UDP-α-D-glucose --> 1,2-diacyl-3-O-(β-D-glucopyranosyl)-sn-glycerol + H+ + UDP (according to UniProt)
the interaction with [[protein|FtsZ]] results in inhibition of [SW|cell division] and an increase of cell size [Pubmed|22931116]
The protein
Effectors of protein activity
oligomerization of [[protein|UgtP]] is inhibited by UDP-Glc and by interaction with [[protein|FtsZ]] [Pubmed|22931116]
oligomerization of [[protein|UgtP]] is inhibited by UDP-Glc and by interaction with [[protein|FtsZ]] [Pubmed|22931116]
the amounts of [[protein|UgtP]] are reduced about threefold during growth with poor carbon sources due to [[protein|ClpP]]-dependent degradation (this requires most likely [[protein|ClpX]] as the chaperone, but [[protein|ClpC]] and [[protein|ClpE]] are also effective) [pubmed|29625553]
Biological materials
Mutant
MGNA-A886 (ypfP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/886 NBRP B. subtilis, Japan]
GP1369 (''[[gene|ugtP]]''::''spc''), available in [SW|Jörg Stülke]'s lab
BKE21920 (Δ[[gene|ugtP]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTAAATTCACCTCAATG, downstream forward: _UP4_TAATGGCGTACTTGAGAGCA
BKK21920 (Δ[[gene|ugtP]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTAAATTCACCTCAATG, downstream forward: _UP4_TAATGGCGTACTTGAGAGCA
MGNA-A886 (ypfP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/886 NBRP B. subtilis, Japan]
GP1369 (''[[gene|ugtP]]''::''spc''), available in [SW|Jörg Stülke]'s lab
BKE21920 ([[gene|ugtP]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTAAATTCACCTCAATG, downstream forward: _UP4_TAATGGCGTACTTGAGAGCA
BKK21920 ([[gene|ugtP]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTAAATTCACCTCAATG, downstream forward: _UP4_TAATGGCGTACTTGAGAGCA
Biological materials
Expression vector
pGP2571, for expression in ''B. subtilis'' (based on [SW|pBQ200], available in [SW|Jörg Stülke]'s lab
pGP2600, for expression/ purification from ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab
References
Original Publications
The protein
Protein family
glycosyltransferase 28 family (with [[protein|YkoN]] and [[protein|MurG]], according to UniProt)
The protein
Paralogous protein(s)
[[this]]
Expression and Regulation
additional information
the amounts of [[protein|UgtP]] are reduced about threefold during growth with poor carbon sources due to [[protein|ClpP]]-dependent degradation [pubmed|29625553]
Biological materials
Expression vectors
pGP2571, for expression in ''B. subtilis'' (based on [SW|pBQ200], available in [SW|Jörg Stülke]'s lab
pGP2600, for expression/ purification from ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab