SubtiBank SubtiBank
Version comparison:

2017-11-17 10:39:242025-05-14 11:31:00

locus

BSU21920

BSU_21920

geneLength

1146

1149

outlinks

bsu

BSU21920

BSU_21920

Gene

Coordinates

2,306,514 → 2,307,662

2,306,514 2,307,662

Gene

Phenotypes of a mutant

cells are bent and distended due to the lack of glucolipids [Pubmed|22362028,27684739]

increased expression of the [[protein|SigM]], [[protein|SigV]], and [[protein|SigX]] regulons [Pubmed|22362028]

altered [SW|localization] of [[protein|MreB]] (irregular clusters instead of helical dots) [Pubmed|22362028]

the inactivation of ''[[gene|ugtP]]'' suppresses the poor and filamentous growth of the ''[[gene|whiA]] [[gene|zapA]]'' double mutant [Pubmed|24097947]

increased conjugation of ICEBs1 [Pubmed|25069588,26833415]

increased levels of cell wall precursors [pubmed|33087775]

cells are bent and distended due to the lack of glucolipids [Pubmed|22362028,27684739]

a [[gene|ugtP]] [[gene|lytE]] double mutant has a severe [SW|cell shape] defect, thi can be suppressed by mutations resulting in reduced expression or activity of [[protein|PonA|PbpA]] [pubmed|33087775]

increased expression of the [[protein|SigM]], [[protein|SigV]], and [[protein|SigX]] regulons [Pubmed|22362028]

altered [SW|localization] of [[protein|MreB]] (irregular clusters instead of helical dots) [Pubmed|22362028]

the inactivation of ''[[gene|ugtP]]'' suppresses the poor and filamentous growth of the ''[[gene|whiA]] [[gene|zapA]]'' double mutant [Pubmed|24097947]

increased conjugation of ICEBs1 [Pubmed|25069588,26833415]

The protein

Catalyzed reaction/ biological activity

UDP-glucose + 1,2-diacylglycerol = UDP + 1,2-diacyl-3-(O-beta-D-glucopyranosyl)-sn-glycerol (according to Swiss-Prot)

the interaction with [[protein|FtsZ]] results in inhibition of [SW|cell division] and an increase of cell size [Pubmed|22931116]

1,2-diacyl-3-O-(β-D-glucopyranosyl)-sn-glycerol + UDP-α-D-glucose --> 1,2-diacyl-3-O-(β-D-Glc-(1→6)-β-D-Glc)-sn-glycerol + H+ + UDP (according to UniProt)

1,2-diacyl-3-O-(β-D-Glc-(1→6)-β-D-Glc)-sn-glycerol + UDP-α-D-glucose --> 1,2-diacyl-3-O-(β-D-Glc-(1→6)-β-D-Glc-(1→6)-β-D-Glc)-sn-glycerol + H+ + UDP (according to UniProt)

1,2-diacyl-sn-glycerol + UDP-α-D-glucose --> 1,2-diacyl-3-O-(β-D-glucopyranosyl)-sn-glycerol + H+ + UDP (according to UniProt)

the interaction with [[protein|FtsZ]] results in inhibition of [SW|cell division] and an increase of cell size [Pubmed|22931116]

The protein

Effectors of protein activity

oligomerization of [[protein|UgtP]] is inhibited by UDP-Glc and by interaction with [[protein|FtsZ]] [Pubmed|22931116]

oligomerization of [[protein|UgtP]] is inhibited by UDP-Glc and by interaction with [[protein|FtsZ]] [Pubmed|22931116]

the amounts of [[protein|UgtP]] are reduced about threefold during growth with poor carbon sources due to [[protein|ClpP]]-dependent degradation (this requires most likely [[protein|ClpX]] as the chaperone, but [[protein|ClpC]] and [[protein|ClpE]] are also effective) [pubmed|29625553]

The protein

Structure

[PDB|4X1T] (galactolipid synthase from Arabidopsis thaliana, 25% identity)

[PDB|4X1T] (galactolipid synthase from Arabidopsis thaliana, 25% identity) [pubmed|26935252]

Biological materials

Mutant

MGNA-A886 (ypfP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/886 NBRP B. subtilis, Japan]

GP1369 (''[[gene|ugtP]]''::''spc''), available in [SW|Jörg Stülke]'s lab

BKE21920 (Δ[[gene|ugtP]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTAAATTCACCTCAATG, downstream forward: _UP4_TAATGGCGTACTTGAGAGCA

BKK21920 (Δ[[gene|ugtP]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTAAATTCACCTCAATG, downstream forward: _UP4_TAATGGCGTACTTGAGAGCA

MGNA-A886 (ypfP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/886 NBRP B. subtilis, Japan]

GP1369 (''[[gene|ugtP]]''::''spc''), available in [SW|Jörg Stülke]'s lab

BKE21920 ([[gene|ugtP]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTAAATTCACCTCAATG, downstream forward: _UP4_TAATGGCGTACTTGAGAGCA

BKK21920 ([[gene|ugtP]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGTAAATTCACCTCAATG, downstream forward: _UP4_TAATGGCGTACTTGAGAGCA

Biological materials

Expression vector

pGP2571, for expression in ''B. subtilis'' (based on [SW|pBQ200], available in [SW|Jörg Stülke]'s lab

pGP2600, for expression/ purification from ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab

References

Original Publications

9244290, 18820022, 17662947, 9720862, 22362028, 15640167, 23935518, 22931116, 24097947, 25069588, 27684739, 26833415

9244290, 18820022, 17662947, 9720862, 22362028, 15640167, 23935518, 22931116, 24097947, 25069588, 27684739, 26833415, 26935252, 29625553, 33087775

The protein

Protein family

glycosyltransferase 28 family (with [[protein|YkoN]] and [[protein|MurG]], according to UniProt)

The protein

Paralogous protein(s)

[[this]]

Expression and Regulation

additional information

the amounts of [[protein|UgtP]] are reduced about threefold during growth with poor carbon sources due to [[protein|ClpP]]-dependent degradation [pubmed|29625553]

Biological materials

Expression vectors

pGP2571, for expression in ''B. subtilis'' (based on [SW|pBQ200], available in [SW|Jörg Stülke]'s lab

pGP2600, for expression/ purification from ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172], available in [SW|Jörg Stülke]'s lab